Rmu_sc0038336.1_g000001

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0038336.1
Physical Location & Seq
Reverse (-)
1 .. 1313
1313 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0038336.1_g000001.1.cds

Sequence Viewer

Length: 766 bp
tcttgagacagtcaatcccaccagatccatagacttcgaagcaatattaaaggatgacgatcgggtgggatataccgtccttccagaagcaccaagattatgggttctgggttcctgcaatggcttgatatgccgggaagaagacgagggaggtgatcttatcttatggaacccttctactcgagatacatgcaagttaccggaacaaattaaaactagaaatcgtcagttttttggatttggttatgattccaccaatcaagattacaaggtcatagtaggccttgaaaccgaaattacagtctttacattaaaaaccggctcatggaagattgttgaacagtccgagtatgttggaaggttttgtggggaggggtgcttattgaacggagctctacattggctagatgacagtcggtcaaaattcacaataatctcttttgatctggtggaggagaaatttcaggagttgccaccacccaatatttggaggaaaggagtctcccttggtattgggaaaactattggcaactgtctcttcctatatctttatgattacaagcgtcatacatcccaaacaggtattgcattaacaatatgggtgctgaacgaatatggggtgaatgaatcttggactagcgttgttcaaattccttcttctagtctatctccatgtcatatttttgattatgaaccgattttggttttagaggatgataaagttttgatgaatcggatcagcaatagaagcgagtggaaccaattg
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

255

Amino Acids

29.17

Weight (kDa)

4.83

Isoelectric Point (pI)

45.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 487
AclWI GGATC 2 cut(s) 19, 744
AcsI RAATTY 3 cut(s) 423, 459, 649
AfiI CCNNNNNNNGG 2 cut(s) 325, 487
AgsI TTSAA 4 cut(s) 288, 339, 386, 648
AhdI GACNNNNNGTC 1 cut(s) 416
AluBI AGCT 1 cut(s) 393
AluI AGCT 1 cut(s) 393
Alw21I GWGCWC 1 cut(s) 395
Alw26I GTCTC 2 cut(s) 506, 540
AlwI GGATC 2 cut(s) 19, 744
Ama87I CYCGRG 1 cut(s) 181
AoxI GGCC 1 cut(s) 281
ApoI RAATTY 3 cut(s) 423, 459, 649
ArsI GACNNNNNNTTYG 2 cut(s) 286, 318
AsuC2I CCSGG 1 cut(s) 135
AsuHPI GGTGA 2 cut(s) 165, 632
AsuII TTCGAA 1 cut(s) 37
AvaI CYCGRG 1 cut(s) 181
BanII GRGCYC 1 cut(s) 395
BbsI GAAGAC 1 cut(s) 148
Bbv12I GWGCWC 1 cut(s) 395
BcgI CGANNNNNNTGC 2 cut(s) 172, 206
BcnI CCSGG 1 cut(s) 135
BcoDI GTCTC 2 cut(s) 506, 540
BfaI CTAG 4 cut(s) 217, 405, 637, 661
Bme1390I CCNGG 1 cut(s) 135
BmeRI GACNNNNNGTC 1 cut(s) 416
BmeT110I CYCGRG 1 cut(s) 181
BmiI GGNNCC 3 cut(s) 113, 171, 759
BmrFI CCNGG 1 cut(s) 135
BpiI GAAGAC 1 cut(s) 148
Bpu14I TTCGAA 1 cut(s) 37
BpuEI CTTGAG 1 cut(s) 24
BpuMI CCSGG 1 cut(s) 135
BsaBI GATNNNNATC 1 cut(s) 58
BsaJI CCNNGG 1 cut(s) 506
BsaWI WCCGGW 1 cut(s) 200
Bsc4I CCNNNNNNNGG 2 cut(s) 325, 487
Bse118I RCCGGY 1 cut(s) 318
Bse3DI GCAATG 1 cut(s) 125
Bse8I GATNNNNATC 1 cut(s) 58
BseDI CCNNGG 1 cut(s) 506
BseGI GGATG 3 cut(s) 59, 570, 719
BseJI GATNNNNATC 1 cut(s) 58
BseLI CCNNNNNNNGG 2 cut(s) 325, 487
BseMI GCAATG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 468
Bsh1285I CGRYCG 1 cut(s) 62
BshFI GGCC 1 cut(s) 283
BsiEI CGRYCG 1 cut(s) 62
BsiHKAI GWGCWC 1 cut(s) 395
BsiHKCI CYCGRG 1 cut(s) 181
BsiSI CCGG 3 cut(s) 134, 201, 319
BslI CCNNNNNNNGG 2 cut(s) 325, 487
BsmAI GTCTC 2 cut(s) 506, 540
BsnI GGCC 1 cut(s) 283
BsoBI CYCGRG 1 cut(s) 181
Bsp119I TTCGAA 1 cut(s) 37
Bsp1286I GDGCHC 1 cut(s) 395
Bsp143I GATC 5 cut(s) 24, 59, 155, 443, 736
BspANI GGCC 1 cut(s) 283
BspLI GGNNCC 3 cut(s) 113, 171, 759
BspPI GGATC 2 cut(s) 19, 744
BspT104I TTCGAA 1 cut(s) 37
BsrDI GCAATG 1 cut(s) 125
BsrFI RCCGGY 1 cut(s) 318
BssAI RCCGGY 1 cut(s) 318
BssECI CCNNGG 1 cut(s) 506
BssMI GATC 5 cut(s) 24, 59, 155, 443, 736
BssT1I CCWWGG 1 cut(s) 506
Bst4CI ACNGT 6 cut(s) 11, 77, 302, 343, 414, 534
Bst6I CTCTTC 1 cut(s) 543
BstBI TTCGAA 1 cut(s) 37
BstF5I GGATG 3 cut(s) 59, 570, 719
BstKTI GATC 5 cut(s) 27, 62, 158, 446, 739
BstMAI GTCTC 2 cut(s) 506, 540
BstMBI GATC 5 cut(s) 24, 59, 155, 443, 736
BstMCI CGRYCG 1 cut(s) 62
BstMWI GCNNNNNNNGC 2 cut(s) 130, 748
BstNSI RCATGY 1 cut(s) 193
BstSCI CCNGG 1 cut(s) 133
BstV2I GAAGAC 1 cut(s) 148
BstX2I RGATCY 1 cut(s) 24
BstXI CCANNNNNNTGG 1 cut(s) 100
BstYI RGATCY 1 cut(s) 24
BsuRI GGCC 1 cut(s) 283
BtsCI GGATG 3 cut(s) 59, 570, 719
Cfr10I RCCGGY 1 cut(s) 318
CseI GACGC 1 cut(s) 552
CviAII CATG 3 cut(s) 190, 325, 673
CviJI RGCY 5 cut(s) 124, 283, 322, 393, 404
CviKI_1 RGCY 5 cut(s) 124, 283, 322, 393, 404
DpnI GATC 5 cut(s) 26, 61, 157, 445, 738
DpnII GATC 5 cut(s) 24, 59, 155, 443, 736
DriI GACNNNNNGTC 1 cut(s) 416
Eam1104I CTCTTC 1 cut(s) 543
Eam1105I GACNNNNNGTC 1 cut(s) 416
EarI CTCTTC 1 cut(s) 543
Ecl136II GAGCTC 1 cut(s) 393
Eco130I CCWWGG 1 cut(s) 506
Eco147I AGGCCT 1 cut(s) 283
Eco24I GRGCYC 1 cut(s) 395
Eco53kI GAGCTC 1 cut(s) 393
Eco88I CYCGRG 1 cut(s) 181
EcoICRI GAGCTC 1 cut(s) 393
EcoT14I CCWWGG 1 cut(s) 506
EcoT38I GRGCYC 1 cut(s) 395
ErhI CCWWGG 1 cut(s) 506
FaeI CATG 3 cut(s) 193, 328, 676
FatI CATG 3 cut(s) 189, 324, 672
FokI GGATG 3 cut(s) 66, 557, 726
FriOI GRGCYC 1 cut(s) 395
FspBI CTAG 4 cut(s) 217, 405, 637, 661
HaeIII GGCC 1 cut(s) 283
HapII CCGG 3 cut(s) 134, 201, 319
HgaI GACGC 1 cut(s) 552
Hin1II CATG 3 cut(s) 193, 328, 676
HinfI GANTC 4 cut(s) 249, 499, 627, 731
HpaII CCGG 3 cut(s) 134, 201, 319
HphI GGTGA 2 cut(s) 165, 632
Hpy188I TCNGA 2 cut(s) 347, 736
Hpy188III TCNNGA 5 cut(s) 3, 84, 183, 261, 465
HpyAV CCTTC 4 cut(s) 90, 184, 352, 664
HpyCH4III ACNGT 6 cut(s) 11, 77, 302, 343, 414, 534
HpyCH4V TGCA 3 cut(s) 118, 193, 588
HpyF10VI GCNNNNNNNGC 2 cut(s) 130, 748
Hsp92II CATG 3 cut(s) 193, 328, 676
Kzo9I GATC 5 cut(s) 24, 59, 155, 443, 736
LmnI GCTCC 1 cut(s) 390
MaeI CTAG 4 cut(s) 217, 405, 637, 661
MaeIII GTNAC 1 cut(s) 196
MalI GATC 5 cut(s) 26, 61, 157, 445, 738
MboI GATC 5 cut(s) 24, 59, 155, 443, 736
MboII GAAGA 5 cut(s) 150, 153, 341, 530, 649
MfeI CAATTG 1 cut(s) 762
MflI RGATCY 1 cut(s) 24
MhlI GDGCHC 1 cut(s) 395
MluCI AATT 6 cut(s) 208, 295, 423, 459, 649, 762
MlyI GAGTC 1 cut(s) 508
MmeI TCCRAC 1 cut(s) 335
MnlI CCTC 6 cut(s) 140, 144, 365, 446, 484, 704
MseI TTAA 4 cut(s) 48, 211, 312, 591
MspI CCGG 3 cut(s) 134, 201, 319
MspR9I CCNGG 1 cut(s) 135
MunI CAATTG 1 cut(s) 762
MwoI GCNNNNNNNGC 2 cut(s) 130, 748
NciI CCSGG 1 cut(s) 135
NdeII GATC 5 cut(s) 24, 59, 155, 443, 736
NlaIII CATG 3 cut(s) 193, 328, 676
NlaIV GGNNCC 3 cut(s) 113, 171, 759
NspI RCATGY 1 cut(s) 193
NspV TTCGAA 1 cut(s) 37
PaeR7I CTCGAG 1 cut(s) 181
PceI AGGCCT 1 cut(s) 283
PfeI GAWTC 3 cut(s) 249, 627, 731
PflMI CCANNNNNTGG 1 cut(s) 487
Ple19I CGATCG 1 cut(s) 62
PleI GAGTC 1 cut(s) 507
PpsI GAGTC 1 cut(s) 507
Psp124BI GAGCTC 1 cut(s) 395
PspN4I GGNNCC 3 cut(s) 113, 171, 759
PsuI RGATCY 1 cut(s) 24
PvuI CGATCG 1 cut(s) 62
SacI GAGCTC 1 cut(s) 395
SaqAI TTAA 4 cut(s) 48, 211, 312, 591
Sau3AI GATC 5 cut(s) 24, 59, 155, 443, 736
SchI GAGTC 1 cut(s) 508
ScrFI CCNGG 1 cut(s) 135
SduI GDGCHC 1 cut(s) 395
SetI ASST 5 cut(s) 155, 274, 363, 395, 584
Sfr274I CTCGAG 1 cut(s) 181
SfuI TTCGAA 1 cut(s) 37
SlaI CTCGAG 1 cut(s) 181
SmlI CTYRAG 2 cut(s) 3, 181
SmoI CTYRAG 2 cut(s) 3, 181
Sse9I AATT 6 cut(s) 208, 295, 423, 459, 649, 762
SseBI AGGCCT 1 cut(s) 283
SspI AATATT 2 cut(s) 46, 485
SspMI CTAG 4 cut(s) 217, 405, 637, 661
SstI GAGCTC 1 cut(s) 395
StuI AGGCCT 1 cut(s) 283
StyD4I CCNGG 1 cut(s) 133
StyI CCWWGG 1 cut(s) 506
TaaI ACNGT 6 cut(s) 11, 77, 302, 343, 414, 534
TaqI TCGA 2 cut(s) 37, 182
TaqII GACCGA 1 cut(s) 406
TasI AATT 6 cut(s) 208, 295, 423, 459, 649, 762
TfiI GAWTC 3 cut(s) 249, 627, 731
Tru1I TTAA 4 cut(s) 48, 211, 312, 591
Tru9I TTAA 4 cut(s) 48, 211, 312, 591
TspDTI ATGAA 3 cut(s) 640, 706, 744
TspGWI ACGGA 1 cut(s) 403
Van91I CCANNNNNTGG 1 cut(s) 487
XapI RAATTY 3 cut(s) 423, 459, 649
XceI RCATGY 1 cut(s) 193
XcmI CCANNNNNNNNNTGG 1 cut(s) 484
XhoI CTCGAG 1 cut(s) 181
XspI CTAG 4 cut(s) 217, 405, 637, 661
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.