Rroxscaffold_2G00095980

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
17260911 .. 17267403
6493 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00095980.1

Sequence Viewer

Length: 300 bp
ATGGTGTCACTATCCAGTTTTGTCGACAAAGAATGTTTGGACCACATTTCCGCCTCTTTGATCGAACCTTTTGCCGAAATTGGGAGTACTATTGAAAATAATCTTCTTGTATACTTTTACGTTCCTAGCAATACCGGTGATACTACGCTTACAATATGGGTGATGAATGAATATGGGGTCAAGGCATCGTGGACTAAACTCTTACACATTACTTCAAAGATTTCAATGGGAAGATATGCATTTGAAAGGCACCGCGAGAAATATGAACATAAACACCGTTATGACCTCCACCGGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.61

Weight (kDa)

6.64

Isoelectric Point (pI)

45.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 249
AccI GTMKAC 2 cut(s) 24, 111
AccII CGCG 1 cut(s) 255
AciI CCGC 2 cut(s) 51, 253
AfaI GTAC 1 cut(s) 88
AfiI CCNNNNNNNGG 1 cut(s) 81
AgeI ACCGGT 1 cut(s) 134
AgsI TTSAA 4 cut(s) 95, 216, 225, 245
AsiGI ACCGGT 1 cut(s) 134
AspS9I GGNCC 1 cut(s) 40
AsuHPI GGTGA 2 cut(s) 149, 172
AvaII GGWCC 1 cut(s) 40
BanI GGYRCC 1 cut(s) 249
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 1 cut(s) 126
BmcAI AGTACT 1 cut(s) 88
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 1 cut(s) 40
BmiI GGNNCC 1 cut(s) 251
BmsI GCATC 1 cut(s) 194
BsaWI WCCGGW 1 cut(s) 134
Bsc4I CCNNNNNNNGG 1 cut(s) 81
Bse118I RCCGGY 2 cut(s) 134, 291
Bse1I ACTGG 1 cut(s) 15
BseLI CCNNNNNNNGG 1 cut(s) 81
BseNI ACTGG 1 cut(s) 15
Bsh1236I CGCG 1 cut(s) 255
BshNI GGYRCC 1 cut(s) 249
BshTI ACCGGT 1 cut(s) 134
BsiSI CCGG 2 cut(s) 135, 292
BslI CCNNNNNNNGG 1 cut(s) 81
Bsp143I GATC 1 cut(s) 60
BspACI CCGC 2 cut(s) 51, 253
BspFNI CGCG 1 cut(s) 255
BspLI GGNNCC 1 cut(s) 251
BspT107I GGYRCC 1 cut(s) 249
BsrFI RCCGGY 2 cut(s) 134, 291
BsrI ACTGG 1 cut(s) 15
BssAI RCCGGY 2 cut(s) 134, 291
BssMI GATC 1 cut(s) 60
BssNAI GTATAC 1 cut(s) 112
Bst1107I GTATAC 1 cut(s) 112
Bst4CI ACNGT 1 cut(s) 278
BstFNI CGCG 1 cut(s) 255
BstKTI GATC 1 cut(s) 63
BstMBI GATC 1 cut(s) 60
BstUI CGCG 1 cut(s) 255
BstZ17I GTATAC 1 cut(s) 112
Cfr10I RCCGGY 2 cut(s) 134, 291
Cfr13I GGNCC 1 cut(s) 40
Csp6I GTAC 1 cut(s) 87
CspAI ACCGGT 1 cut(s) 134
CviQI GTAC 1 cut(s) 87
DpnI GATC 1 cut(s) 62
DpnII GATC 1 cut(s) 60
EciI GGCGGA 1 cut(s) 40
Eco47I GGWCC 1 cut(s) 40
EcoT22I ATGCAT 1 cut(s) 241
FaiI YATR 7 cut(s) 112, 157, 174, 237, 264, 270, 282
FblI GTMKAC 2 cut(s) 24, 111
FspBI CTAG 1 cut(s) 126
HapII CCGG 2 cut(s) 135, 292
HincII GTYRAC 1 cut(s) 25
HindII GTYRAC 1 cut(s) 25
HpaII CCGG 2 cut(s) 135, 292
HphI GGTGA 2 cut(s) 149, 172
Hpy166II GTNNAC 3 cut(s) 25, 112, 192
Hpy8I GTNNAC 3 cut(s) 25, 112, 192
HpyCH4III ACNGT 1 cut(s) 278
HpyCH4IV ACGT 1 cut(s) 120
HpyCH4V TGCA 1 cut(s) 239
HpySE526I ACGT 1 cut(s) 120
Kzo9I GATC 1 cut(s) 60
LpnPI CCDG 2 cut(s) 28, 148
LweI GCATC 1 cut(s) 194
MaeI CTAG 1 cut(s) 126
MaeII ACGT 1 cut(s) 120
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 62
MboI GATC 1 cut(s) 60
MboII GAAGA 2 cut(s) 95, 243
MluCI AATT 1 cut(s) 78
MnlI CCTC 2 cut(s) 64, 296
Mph1103I ATGCAT 1 cut(s) 241
MslI CAYNNNNRTG 1 cut(s) 279
MspI CCGG 2 cut(s) 135, 292
MvnI CGCG 1 cut(s) 255
NdeII GATC 1 cut(s) 60
NlaIV GGNNCC 1 cut(s) 251
NmuCI GTSAC 1 cut(s) 6
NsiI ATGCAT 1 cut(s) 241
PinAI ACCGGT 1 cut(s) 134
PspN4I GGNNCC 1 cut(s) 251
PspPI GGNCC 1 cut(s) 40
RsaI GTAC 1 cut(s) 88
RsaNI GTAC 1 cut(s) 87
RseI CAYNNNNRTG 1 cut(s) 279
SalI GTCGAC 1 cut(s) 23
Sau3AI GATC 1 cut(s) 60
Sau96I GGNCC 1 cut(s) 40
ScaI AGTACT 1 cut(s) 88
SetI ASST 3 cut(s) 70, 123, 288
SfaNI GCATC 1 cut(s) 194
SgeI CNNG 8 cut(s) 27, 119, 138, 147, 193, 201, 266, 268
SinI GGWCC 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 279
Sse9I AATT 1 cut(s) 78
SsiI CCGC 2 cut(s) 51, 253
SspMI CTAG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 278
TaiI ACGT 1 cut(s) 123
TaqI TCGA 2 cut(s) 24, 63
TasI AATT 1 cut(s) 78
TatI WGTACW 1 cut(s) 86
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
TspDTI ATGAA 3 cut(s) 179, 183, 279
VpaK11BI GGWCC 1 cut(s) 40
XmiI GTMKAC 2 cut(s) 24, 111
XspI CTAG 1 cut(s) 126
ZrmI AGTACT 1 cut(s) 88
Zsp2I ATGCAT 1 cut(s) 241
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.