Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001707.1

Orthogroup ID

OG0004848

Physical Location & Seq

Genomic Coordinates Forward (+)

44487 .. 45652

Gene Structure 1166 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001707.1_g000011.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1089 bp

atggggaacatcatcttcatctctttatcatgctatggcgttctttcccgttgctgggattccatcaccagacgagcgacatatgtagggcttgaaggtgctttcagcaacccctctccctcatgggatggttgttttaacgatgacctaattgttgagatactgtcgcggcttccagccaaatctttactacggtttcgttgtgtatgcaagtcatggcttgctttgatctctgatccctattttgctaggaagcacatcagcacatacaacaacaggttgaagcttcttgagacagtcaatcccaccagatccatagacttcgaagcaatattaaaggatgacgatcgggtgggatataccgtcctaccagaagcaccaagattatgggttctgggttcctgcaatggcttgatatggaagaagacgagggagttttttggatttggttatgattccaccaatcaagattacaaggtcatagtaggccttgaaaccgaaattacagtctttacattaaaaaccggctcatggaagattgttgaacagtccgagtatgttggaaggttttgtggggaggggtgcttattgaacggagctctacattggctagatgacagtcggtcaaaattcacaataatctcttttgatctggtggaggagaaatttcaggagttgccaccacccaatatttggaggaaaggagtctaccttggtattgggaaaactattggcaactgtctcttcctatatctttatgataacaagcgtcatacgtcccaaacaggtattgcatttacaatatgggtgctgaacgaatatggggtgaatgaatcttggactatagttgttcaaattccttcttctagtctatctccatgtcatatttttgattatgaaccgattttggctttagaggatgataaagttttgatgaatcggatcagcaatagaagcgagtggaaccaattggtattgtatactcccaaggaaaaccgtcaaaagaaatatagacgtcttattcatgactattacataatgcccaaattatacgtggaaactttagtatcgccaaaaataggtagatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

F-box FBA_1

Protein Analysis

362

Amino Acids

41.8

Weight (kDa)

8.23

Isoelectric Point (pI)

44.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004848)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g18082 FvH4_6g43211
malus_domestica	MD09G1135400.v1.1 MD17G1131100.v1.1
prunus_persica	Prupe.3G191300_v2.0.a1
pyrus_communis	pycom420g00950
rosa_chinensis	RchiOBHm_Chr5g0030151 RchiOBHm_Chr7g0203691
rosa_laevigata	RLG00000005803 RLG00000022101
rosa_multiflora	Rmu_co8245821.1_g000001 Rmu_sc0001707.1_g000011 Rmu_sc0005354.1_g000006 Rmu_sc0005969.1_g000041 Rmu_sc0038336.1_g000001
rosa_roxburghii	Rroxscaffold_1G00049840 Rroxscaffold_1G00049860 Rroxscaffold_2G00093700 Rroxscaffold_2G00093750 Rroxscaffold_2G00095980 Rroxscaffold_2G00096010 Rroxscaffold_6G00426490
rosa_rugosa	Rorug02G0430700 Rorug02G0447100 Rorug02G0558400 Rorug02G0610800 Rorug05G0117300
rosa_samantha	Rh2AG633400 Rh2BG647000
rosa_wichuraiana	Rw5G019160 Rw5G019190

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	1018
AccB7I	CCANNNNNTGG	1 cut(s)	693
AccI	GTMKAC	2 cut(s)	708, 980
AccII	CGCG	1 cut(s)	169
AciI	CCGC	1 cut(s)	169
AclWI	GGATC	3 cut(s)	230, 306, 950
AcsI	RAATTY	3 cut(s)	629, 665, 855
AcyI	GRCGYC	1 cut(s)	1015
AfiI	CCNNNNNNNGG	5 cut(s)	54, 55, 531, 693, 1079
AgsI	TTSAA	6 cut(s)	95, 283, 494, 545, 592, 854
AhdI	GACNNNNNGTC	1 cut(s)	622
AluBI	AGCT	2 cut(s)	286, 599
AluI	AGCT	2 cut(s)	286, 599
Alw21I	GWGCWC	1 cut(s)	601
Alw26I	GTCTC	2 cut(s)	287, 746
AlwI	GGATC	3 cut(s)	230, 306, 950
AoxI	GGCC	1 cut(s)	487
ApoI	RAATTY	3 cut(s)	629, 665, 855
ArsI	GACNNNNNNTTYG	2 cut(s)	492, 524
AsuHPI	GGTGA	2 cut(s)	58, 838
AsuII	TTCGAA	1 cut(s)	324
BaeI	ACNNNNGTAYC	2 cut(s)	1050, 1083
BanII	GRGCYC	1 cut(s)	601
BbsI	GAAGAC	1 cut(s)	431
Bbv12I	GWGCWC	1 cut(s)	601
BccI	CCATC	2 cut(s)	71, 122
BcoDI	GTCTC	2 cut(s)	287, 746
BfaI	CTAG	3 cut(s)	249, 611, 867
BfmI	CTRYAG	1 cut(s)	843
BisI	GCNGC	1 cut(s)	170
BlsI	GCNGC	1 cut(s)	171
BmeRI	GACNNNNNGTC	1 cut(s)	622
BmiI	GGNNCC	2 cut(s)	400, 965
BpiI	GAAGAC	1 cut(s)	431
Bpu14I	TTCGAA	1 cut(s)	324
BpuEI	CTTGAG	1 cut(s)	311
BsaAI	YACGTR	1 cut(s)	1054
BsaBI	GATNNNNATC	1 cut(s)	345
BsaHI	GRCGYC	1 cut(s)	1015
BsaJI	CCNNGG	2 cut(s)	712, 987
Bsc4I	CCNNNNNNNGG	5 cut(s)	54, 55, 531, 693, 1079
Bse118I	RCCGGY	1 cut(s)	524
Bse3DI	GCAATG	1 cut(s)	412
Bse8I	GATNNNNATC	1 cut(s)	345
BseDI	CCNNGG	2 cut(s)	712, 987
BseGI	GGATG	3 cut(s)	133, 346, 925
BseJI	GATNNNNATC	1 cut(s)	345
BseLI	CCNNNNNNNGG	5 cut(s)	54, 55, 531, 693, 1079
BseMI	GCAATG	1 cut(s)	412
BseRI	GAGGAG	1 cut(s)	674
BseYI	CCCAGC	1 cut(s)	54
Bsh1236I	CGCG	1 cut(s)	169
Bsh1285I	CGRYCG	1 cut(s)	349
BshFI	GGCC	1 cut(s)	489
BsiEI	CGRYCG	1 cut(s)	349
BsiHKAI	GWGCWC	1 cut(s)	601
BsiSI	CCGG	1 cut(s)	525
BslFI	GGGAC	1 cut(s)	763
BslI	CCNNNNNNNGG	5 cut(s)	54, 55, 531, 693, 1079
BsmAI	GTCTC	2 cut(s)	287, 746
BsmFI	GGGAC	1 cut(s)	763
BsnI	GGCC	1 cut(s)	489
Bsp119I	TTCGAA	1 cut(s)	324
Bsp1286I	GDGCHC	1 cut(s)	601
Bsp143I	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
BspACI	CCGC	1 cut(s)	169
BspANI	GGCC	1 cut(s)	489
BspFNI	CGCG	1 cut(s)	169
BspHI	TCATGA	1 cut(s)	1024
BspLI	GGNNCC	2 cut(s)	400, 965
BspPI	GGATC	3 cut(s)	230, 306, 950
BspT104I	TTCGAA	1 cut(s)	324
BsrDI	GCAATG	1 cut(s)	412
BsrFI	RCCGGY	1 cut(s)	524
BssAI	RCCGGY	1 cut(s)	524
BssECI	CCNNGG	2 cut(s)	712, 987
BssMI	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
BssNAI	GTATAC	1 cut(s)	981
BssNI	GRCGYC	1 cut(s)	1015
BssT1I	CCWWGG	2 cut(s)	712, 987
Bst1107I	GTATAC	1 cut(s)	981
Bst4CI	ACNGT	9 cut(s)	165, 195, 298, 364, 508, 549, 620, 740, 998
Bst6I	CTCTTC	1 cut(s)	749
BstACI	GRCGYC	1 cut(s)	1015
BstBAI	YACGTR	1 cut(s)	1054
BstBI	TTCGAA	1 cut(s)	324
BstC8I	GCNNGC	1 cut(s)	222
BstF5I	GGATG	3 cut(s)	133, 346, 925
BstFNI	CGCG	1 cut(s)	169
BstKTI	GATC	6 cut(s)	231, 238, 314, 349, 652, 945
BstMAI	GTCTC	2 cut(s)	287, 746
BstMBI	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
BstMCI	CGRYCG	1 cut(s)	349
BstMWI	GCNNNNNNNGC	1 cut(s)	954
BstSFI	CTRYAG	1 cut(s)	843
BstUI	CGCG	1 cut(s)	169
BstV2I	GAAGAC	1 cut(s)	431
BstX2I	RGATCY	1 cut(s)	311
BstXI	CCANNNNNNTGG	1 cut(s)	387
BstYI	RGATCY	1 cut(s)	311
BstZ17I	GTATAC	1 cut(s)	981
BsuRI	GGCC	1 cut(s)	489
BtsCI	GGATG	3 cut(s)	133, 346, 925
Cac8I	GCNNGC	1 cut(s)	222
CciI	TCATGA	1 cut(s)	1024
Cfr10I	RCCGGY	1 cut(s)	524
CseI	GACGC	1 cut(s)	758
CviAII	CATG	6 cut(s)	30, 123, 216, 531, 879, 1025
DpnI	GATC	6 cut(s)	230, 237, 313, 348, 651, 944
DpnII	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
DriI	GACNNNNNGTC	1 cut(s)	622
Eam1104I	CTCTTC	1 cut(s)	749
Eam1105I	GACNNNNNGTC	1 cut(s)	622
EarI	CTCTTC	1 cut(s)	749
Ecl136II	GAGCTC	1 cut(s)	599
Eco130I	CCWWGG	2 cut(s)	712, 987
Eco147I	AGGCCT	1 cut(s)	489
Eco24I	GRGCYC	1 cut(s)	601
Eco53kI	GAGCTC	1 cut(s)	599
EcoICRI	GAGCTC	1 cut(s)	599
EcoT14I	CCWWGG	2 cut(s)	712, 987
EcoT38I	GRGCYC	1 cut(s)	601
ErhI	CCWWGG	2 cut(s)	712, 987
FaeI	CATG	6 cut(s)	33, 126, 219, 534, 882, 1028
FaqI	GGGAC	1 cut(s)	763
FatI	CATG	6 cut(s)	29, 122, 215, 530, 878, 1024
FauNDI	CATATG	1 cut(s)	82
FblI	GTMKAC	2 cut(s)	708, 980
Fnu4HI	GCNGC	1 cut(s)	170
FokI	GGATG	3 cut(s)	140, 353, 932
FriOI	GRGCYC	1 cut(s)	601
Fsp4HI	GCNGC	1 cut(s)	170
FspBI	CTAG	3 cut(s)	249, 611, 867
GluI	GCNGC	1 cut(s)	170
GsaI	CCCAGC	1 cut(s)	58
HaeIII	GGCC	1 cut(s)	489
HapII	CCGG	1 cut(s)	525
HgaI	GACGC	1 cut(s)	758
Hin1I	GRCGYC	1 cut(s)	1015
Hin1II	CATG	6 cut(s)	33, 126, 219, 534, 882, 1028
HindIII	AAGCTT	1 cut(s)	284
HinfI	GANTC	5 cut(s)	59, 455, 705, 833, 937
HpaII	CCGG	1 cut(s)	525
HphI	GGTGA	2 cut(s)	58, 838
Hpy166II	GTNNAC	2 cut(s)	709, 981
Hpy188I	TCNGA	3 cut(s)	235, 553, 942
Hpy188III	TCNNGA	4 cut(s)	290, 467, 671, 1025
Hpy8I	GTNNAC	2 cut(s)	709, 981
HpyAV	CCTTC	3 cut(s)	89, 558, 870
HpyCH4III	ACNGT	9 cut(s)	165, 195, 298, 364, 508, 549, 620, 740, 998
HpyCH4IV	ACGT	3 cut(s)	776, 1015, 1053
HpyCH4V	TGCA	3 cut(s)	210, 405, 794
HpyF10VI	GCNNNNNNNGC	1 cut(s)	954
HpySE526I	ACGT	3 cut(s)	776, 1015, 1053
Hsp92I	GRCGYC	1 cut(s)	1015
Hsp92II	CATG	6 cut(s)	33, 126, 219, 534, 882, 1028
Kzo9I	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
LmnI	GCTCC	1 cut(s)	596
MaeI	CTAG	3 cut(s)	249, 611, 867
MaeII	ACGT	3 cut(s)	776, 1015, 1053
MalI	GATC	6 cut(s)	230, 237, 313, 348, 651, 944
MboI	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
MboII	GAAGA	6 cut(s)	7, 433, 436, 547, 736, 855
MfeI	CAATTG	1 cut(s)	968
MflI	RGATCY	1 cut(s)	311
MhlI	GDGCHC	1 cut(s)	601
MluCI	AATT	7 cut(s)	150, 501, 629, 665, 855, 968, 1046
MlyI	GAGTC	1 cut(s)	714
MmeI	TCCRAC	1 cut(s)	541
MnlI	CCTC	7 cut(s)	124, 130, 423, 571, 652, 690, 910
MseI	TTAA	3 cut(s)	138, 335, 518
MspI	CCGG	1 cut(s)	525
MunI	CAATTG	1 cut(s)	968
MvnI	CGCG	1 cut(s)	169
MwoI	GCNNNNNNNGC	1 cut(s)	954
NdeI	CATATG	1 cut(s)	82
NdeII	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
NlaIII	CATG	6 cut(s)	33, 126, 219, 534, 882, 1028
NlaIV	GGNNCC	2 cut(s)	400, 965
NspV	TTCGAA	1 cut(s)	324
PagI	TCATGA	1 cut(s)	1024
PceI	AGGCCT	1 cut(s)	489
PfeI	GAWTC	4 cut(s)	59, 455, 833, 937
PflMI	CCANNNNNTGG	1 cut(s)	693
PkrI	GCNGC	1 cut(s)	171
Ple19I	CGATCG	1 cut(s)	349
PleI	GAGTC	1 cut(s)	713
PpsI	GAGTC	1 cut(s)	713
Ppu21I	YACGTR	1 cut(s)	1054
Psp124BI	GAGCTC	1 cut(s)	601
PspFI	CCCAGC	1 cut(s)	54
PspN4I	GGNNCC	2 cut(s)	400, 965
PsuI	RGATCY	1 cut(s)	311
PvuI	CGATCG	1 cut(s)	349
SacI	GAGCTC	1 cut(s)	601
SaqAI	TTAA	3 cut(s)	138, 335, 518
SatI	GCNGC	1 cut(s)	170
Sau3AI	GATC	6 cut(s)	228, 235, 311, 346, 649, 942
SchI	GAGTC	1 cut(s)	714
SduI	GDGCHC	1 cut(s)	601
SfcI	CTRYAG	1 cut(s)	843
SfuI	TTCGAA	1 cut(s)	324
SmlI	CTYRAG	1 cut(s)	290
SmoI	CTYRAG	1 cut(s)	290
Sse9I	AATT	7 cut(s)	150, 501, 629, 665, 855, 968, 1046
SseBI	AGGCCT	1 cut(s)	489
SsiI	CCGC	1 cut(s)	169
SspI	AATATT	2 cut(s)	333, 691
SspMI	CTAG	3 cut(s)	249, 611, 867
SstI	GAGCTC	1 cut(s)	601
StuI	AGGCCT	1 cut(s)	489
StyI	CCWWGG	2 cut(s)	712, 987
TaaI	ACNGT	9 cut(s)	165, 195, 298, 364, 508, 549, 620, 740, 998
TaiI	ACGT	3 cut(s)	779, 1018, 1056
TaqI	TCGA	1 cut(s)	324
TaqII	GACCGA	1 cut(s)	612
TasI	AATT	7 cut(s)	150, 501, 629, 665, 855, 968, 1046
TauI	GCSGC	1 cut(s)	172
TfiI	GAWTC	4 cut(s)	59, 455, 833, 937
Tru1I	TTAA	3 cut(s)	138, 335, 518
Tru9I	TTAA	3 cut(s)	138, 335, 518
TspDTI	ATGAA	5 cut(s)	7, 846, 912, 950, 1013
TspGWI	ACGGA	1 cut(s)	609
Van91I	CCANNNNNTGG	1 cut(s)	693
XapI	RAATTY	3 cut(s)	629, 665, 855
XcmI	CCANNNNNNNNNTGG	2 cut(s)	690, 1051
XmiI	GTMKAC	2 cut(s)	708, 980
XspI	CTAG	3 cut(s)	249, 611, 867
ZraI	GACGTC	1 cut(s)	1016

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.