Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000704.1

Orthogroup ID

OG0005558

Physical Location & Seq

Genomic Coordinates Reverse (-)

51623 .. 53982

Gene Structure 2360 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000704.1_g000010.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1242 bp

atgttaaccaacagaagttttctatgtgtcaatcatagagattcatatctctatgtcaattcccacagatacttgccaaacgcaaaaccttacaaaaacctcaagagctcccacgtcgtcgtcgcggacccttcccgcaacctctggttccgcctctacactcccaccgccgctaccaccaagctccccatcatcgtcttcttccacggcggcgggttcgccttcatgtccgccgcttcaaaaccctacgacgacttctgtcagcgcctcgctcgcgagctccccaccgccgtcgtctccgacaactaccgcctcgcgccggagcatcggtattcgcgccagtacgactacgcgcaccacgtggcgatcagagcgagcgggcacgagtttcgggatctgaaagtggtcggaatgttggcgattcagccgtttttcggtggagagaagcggacggaatcggagacgagattgaagagggtgccgctggtgaacatagagaggacggactggatgtggaaggcgtttttgccggaggggttggatcgggaccacccggtggtcaatgtgttcgggccgaacgcagtggatatttcgggggttgattttccggcgacgattgtgtttgttgggggatttgatccgttgcaggattggcagaagagatgcacaaagacaaaccaaaggggggcaaggaccaaagccacgccccaaactcgcaagcagctgccatccttgcccagcgtcggaggccagcagcgcagcgcatcactacacctcccagggcatcatgacaggcttgacagcaacccctcccatctagacctcacatatgcacccaatgcagcaggcaccctttcgcctcactcccttgaacctcagaggccaacttcaccatctccaccaacaggtggatatgataaggatacccacaaggaaagaaagcaagctgaaaaggaaaccatgccatcccaaataagcaatccaaccatagcccattacctgaacctgttggacaccagagacgctaagtctcgaccagggggtcacttaagcaagggatgccagaaaagccagcatgcagaggcaattagatcggaggaaggaggaggaagaaggagaacaagtatttggatgttgattgtgggggcaaaacggagaccggttcaacaaaaattaaaactcagtgggggcagctgcccccactcgtccctatgtgcgtccgccactgctacgagggattga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04075 map04075

Pfam Domains

Protein Families

Abhydrolase_3

Protein Analysis

413

Amino Acids

46.16

Weight (kDa)

9.79

Isoelectric Point (pI)

53.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005558)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0329171 RchiOBHm_Chr3g0465871 RchiOBHm_Chr3g0465881 RchiOBHm_Chr5g0077491
rosa_laevigata	RLG00000003324 RLG00000018512 RLG00000022062
rosa_multiflora	Rmu_co8434517.1_g000001 Rmu_sc0000704.1_g000010 Rmu_sc0001524.1_g000020 Rmu_sc0003323.1_g000019 Rmu_sc0005816.1_g000009 Rmu_sc0007705.1_g000011 Rmu_sc0009386.1_g000005 Rmu_sc0011593.1_g000008
rosa_roxburghii	Rroxscaffold_5G00362020
rosa_rugosa	Rorug02G0311000
rosa_samantha	Rh1BG155000 Rh1CG078400 Rh1DG084800 Rh1DG455000 Rh2BG224200 Rh3BG145100 Rh3DG146200 Rh5AG378500 Rh5AG506900 Rh5CG262800 Rh5CG400500
rosa_wichuraiana	Rw3G011730

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	1041
AccB1I	GGYRCC	2 cut(s)	478, 848
AccB7I	CCANNNNNTGG	2 cut(s)	556, 908
AccBSI	CCGCTC	1 cut(s)	378
AccII	CGCG	5 cut(s)	125, 276, 317, 337, 353
AclWI	GGATC	3 cut(s)	402, 549, 632
AcvI	CACGTG	1 cut(s)	361
AdeI	CACNNNGTG	2 cut(s)	361, 556
AfaI	GTAC	1 cut(s)	344
AfiI	CCNNNNNNNGG	7 cut(s)	319, 434, 556, 685, 743, 905, 908
AflII	CTTAAG	1 cut(s)	1048
AgeI	ACCGGT	1 cut(s)	1159
AgsI	TTSAA	4 cut(s)	240, 472, 872, 1166
AhdI	GACNNNNNGTC	1 cut(s)	1027
AjiI	CACGTC	1 cut(s)	115
AjnI	CCWGG	2 cut(s)	778, 1036
AjuI	GAANNNNNNNTTGG	2 cut(s)	1111, 1143
AluBI	AGCT	6 cut(s)	108, 184, 280, 724, 947, 1194
AluI	AGCT	6 cut(s)	108, 184, 280, 724, 947, 1194
Alw21I	GWGCWC	2 cut(s)	110, 282
Alw26I	GTCTC	5 cut(s)	301, 455, 1014, 1035, 1150
AlwI	GGATC	3 cut(s)	402, 549, 632
AoxI	GGCC	3 cut(s)	572, 748, 881
ApeKI	GCWGC	7 cut(s)	721, 724, 754, 759, 842, 1191, 1194
AsiGI	ACCGGT	1 cut(s)	1159
AspLEI	GCGC	6 cut(s)	267, 319, 339, 355, 759, 764
AspS9I	GGNCC	4 cut(s)	127, 547, 572, 693
AsuC2I	CCSGG	1 cut(s)	554
AsuHPI	GGTGA	2 cut(s)	499, 882
AvaII	GGWCC	3 cut(s)	127, 547, 693
BaeGI	GKGCMC	1 cut(s)	384
BanI	GGYRCC	2 cut(s)	478, 848
BanII	GRGCYC	2 cut(s)	110, 282
BauI	CACGAG	1 cut(s)	383
BbrPI	CACGTG	1 cut(s)	361
BbsI	GAAGAC	1 cut(s)	190
Bbv12I	GWGCWC	2 cut(s)	110, 282
BbvI	GCAGC	7 cut(s)	711, 733, 766, 771, 854, 1181, 1203
BccI	CCATC	5 cut(s)	197, 736, 822, 901, 973
BceAI	ACGGC	3 cut(s)	223, 275, 412
BcgI	CGANNNNNNTGC	4 cut(s)	371, 405, 1074, 1108
BciT130I	CCWGG	2 cut(s)	780, 1038
BciVI	GTATCC	1 cut(s)	916
BcnI	CCSGG	1 cut(s)	554
BcoDI	GTCTC	5 cut(s)	301, 455, 1014, 1035, 1150
BfaI	CTAG	1 cut(s)	818
BfoI	RGCGCY	1 cut(s)	268
BfrI	CTTAAG	1 cut(s)	1048
BfuI	GTATCC	1 cut(s)	916
Bme1390I	CCNGG	3 cut(s)	554, 780, 1038
Bme18I	GGWCC	3 cut(s)	127, 547, 693
BmeRI	GACNNNNNGTC	1 cut(s)	1027
BmgBI	CACGTC	1 cut(s)	115
BmgT120I	GGNCC	4 cut(s)	127, 547, 572, 693
BmiI	GGNNCC	5 cut(s)	129, 149, 480, 548, 850
BmrFI	CCNGG	3 cut(s)	554, 780, 1038
BmsI	GCATC	5 cut(s)	334, 653, 773, 793, 1049
BoxI	GACNNNNGTC	1 cut(s)	258
BpiI	GAAGAC	1 cut(s)	190
BpuEI	CTTGAG	1 cut(s)	86
BpuMI	CCSGG	1 cut(s)	554
BsaAI	YACGTR	1 cut(s)	361
BsaBI	GATNNNNATC	1 cut(s)	45
BsaI	GGTCTC	1 cut(s)	1150
BsaJI	CCNNGG	4 cut(s)	205, 778, 779, 1037
BsaWI	WCCGGW	1 cut(s)	1159
BsaXI	ACNNNNNCTCC	6 cut(s)	314, 344, 759, 789, 1108, 1138
Bsc4I	CCNNNNNNNGG	7 cut(s)	319, 434, 556, 685, 743, 905, 908
Bse118I	RCCGGY	1 cut(s)	1159
Bse1I	ACTGG	2 cut(s)	340, 512
Bse8I	GATNNNNATC	1 cut(s)	45
BseBI	CCWGG	2 cut(s)	780, 1038
BseDI	CCNNGG	4 cut(s)	205, 778, 779, 1037
BseGI	GGATG	5 cut(s)	516, 728, 965, 1064, 1137
BseJI	GATNNNNATC	1 cut(s)	45
BseLI	CCNNNNNNNGG	7 cut(s)	319, 434, 556, 685, 743, 905, 908
BseMII	CTCAG	2 cut(s)	890, 1195
BseNI	ACTGG	2 cut(s)	340, 512
BseRI	GAGGAG	1 cut(s)	1119
BseSI	GKGCMC	1 cut(s)	384
BseXI	GCAGC	7 cut(s)	711, 733, 766, 771, 854, 1181, 1203
BseYI	CCCAGC	1 cut(s)	737
Bsh1236I	CGCG	5 cut(s)	125, 276, 317, 337, 353
BshFI	GGCC	3 cut(s)	574, 750, 883
BshNI	GGYRCC	2 cut(s)	478, 848
BshTI	ACCGGT	1 cut(s)	1159
BsiHKAI	GWGCWC	2 cut(s)	110, 282
BsiSI	CCGG	5 cut(s)	320, 530, 554, 608, 1160
BslFI	GGGAC	2 cut(s)	560, 1192
BslI	CCNNNNNNNGG	7 cut(s)	319, 434, 556, 685, 743, 905, 908
BsmAI	GTCTC	5 cut(s)	301, 455, 1014, 1035, 1150
BsmBI	CGTCTC	3 cut(s)	301, 455, 1014
BsmFI	GGGAC	2 cut(s)	560, 1192
BsnI	GGCC	3 cut(s)	574, 750, 883
Bso31I	GGTCTC	1 cut(s)	1150
Bsp1286I	GDGCHC	3 cut(s)	110, 282, 384
Bsp143I	GATC	5 cut(s)	366, 394, 541, 637, 1091
Bsp68I	TCGCGA	1 cut(s)	276
BspANI	GGCC	3 cut(s)	574, 750, 883
BspCNI	CTCAG	2 cut(s)	889, 1194
BspFNI	CGCG	5 cut(s)	125, 276, 317, 337, 353
BspHI	TCATGA	1 cut(s)	787
BspLI	GGNNCC	5 cut(s)	129, 149, 480, 548, 850
BspPI	GGATC	3 cut(s)	402, 549, 632
BspT107I	GGYRCC	2 cut(s)	478, 848
BspTI	CTTAAG	1 cut(s)	1048
BspTNI	GGTCTC	1 cut(s)	1150
BsrBI	CCGCTC	1 cut(s)	378
BsrFI	RCCGGY	1 cut(s)	1159
BsrI	ACTGG	2 cut(s)	340, 512
BssAI	RCCGGY	1 cut(s)	1159
BssECI	CCNNGG	4 cut(s)	205, 778, 779, 1037
BssMI	GATC	5 cut(s)	366, 394, 541, 637, 1091
BssSI	CACGAG	1 cut(s)	383
Bst2BI	CACGAG	1 cut(s)	383
Bst2UI	CCWGG	2 cut(s)	780, 1038
Bst6I	CTCTTC	2 cut(s)	467, 653
BstAFI	CTTAAG	1 cut(s)	1048
BstAPI	GCANNNNNTGC	2 cut(s)	839, 1059
BstBAI	YACGTR	1 cut(s)	361
BstDEI	CTNAG	3 cut(s)	876, 1026, 1181
BstDSI	CCRYGG	1 cut(s)	205
BstF5I	GGATG	5 cut(s)	516, 728, 965, 1064, 1137
BstFNI	CGCG	5 cut(s)	125, 276, 317, 337, 353
BstH2I	RGCGCY	1 cut(s)	268
BstHHI	GCGC	6 cut(s)	267, 319, 339, 355, 759, 764
BstKTI	GATC	5 cut(s)	369, 397, 544, 640, 1094
BstMAI	GTCTC	5 cut(s)	301, 455, 1014, 1035, 1150
BstMBI	GATC	5 cut(s)	366, 394, 541, 637, 1091
BstMWI	GCNNNNNNNGC	9 cut(s)	273, 371, 652, 733, 747, 756, 839, 1059, 1068
BstNI	CCWGG	2 cut(s)	780, 1038
BstNSI	RCATGY	1 cut(s)	1079
BstPAI	GACNNNNGTC	1 cut(s)	258
BstSCI	CCNGG	3 cut(s)	552, 778, 1036
BstSLI	GKGCMC	1 cut(s)	384
BstUI	CGCG	5 cut(s)	125, 276, 317, 337, 353
BstV1I	GCAGC	7 cut(s)	711, 733, 766, 771, 854, 1181, 1203
BstV2I	GAAGAC	1 cut(s)	190
BstX2I	RGATCY	1 cut(s)	394
BstYI	RGATCY	1 cut(s)	394
BsuI	GTATCC	1 cut(s)	916
BsuRI	GGCC	3 cut(s)	574, 750, 883
BtgI	CCRYGG	1 cut(s)	205
BtrI	CACGTC	1 cut(s)	115
BtsCI	GGATG	5 cut(s)	516, 728, 965, 1064, 1137
BtsI	GCAGTG	2 cut(s)	588, 1224
BtsIMutI	CAGTG	3 cut(s)	588, 1189, 1224
BtuMI	TCGCGA	1 cut(s)	276
CciI	TCATGA	1 cut(s)	787
CfoI	GCGC	6 cut(s)	267, 319, 339, 355, 759, 764
Cfr10I	RCCGGY	1 cut(s)	1159
Cfr13I	GGNCC	4 cut(s)	127, 547, 572, 693
CseI	GACGC	3 cut(s)	730, 1031, 1206
Csp6I	GTAC	1 cut(s)	343
CspAI	ACCGGT	1 cut(s)	1159
CviAII	CATG	4 cut(s)	226, 788, 961, 1076
CviQI	GTAC	1 cut(s)	343
DdeI	CTNAG	3 cut(s)	876, 1026, 1181
DpnI	GATC	5 cut(s)	368, 396, 543, 639, 1093
DpnII	GATC	5 cut(s)	366, 394, 541, 637, 1091
DraIII	CACNNNGTG	2 cut(s)	361, 556
DrdI	GACNNNNNNGTC	1 cut(s)	1041
DriI	GACNNNNNGTC	1 cut(s)	1027
DseDI	GACNNNNNNGTC	1 cut(s)	1041
Eam1104I	CTCTTC	2 cut(s)	467, 653
Eam1105I	GACNNNNNGTC	1 cut(s)	1027
EarI	CTCTTC	2 cut(s)	467, 653
EciI	GGCGGA	3 cut(s)	140, 220, 1210
Ecl136II	GAGCTC	2 cut(s)	108, 280
Eco24I	GRGCYC	2 cut(s)	110, 282
Eco31I	GGTCTC	1 cut(s)	1150
Eco47I	GGWCC	3 cut(s)	127, 547, 693
Eco53kI	GAGCTC	2 cut(s)	108, 280
Eco72I	CACGTG	1 cut(s)	361
EcoICRI	GAGCTC	2 cut(s)	108, 280
EcoRII	CCWGG	2 cut(s)	778, 1036
EcoT38I	GRGCYC	2 cut(s)	110, 282
Esp3I	CGTCTC	3 cut(s)	301, 455, 1014
FaeI	CATG	4 cut(s)	229, 791, 964, 1079
FaqI	GGGAC	2 cut(s)	560, 1192
FatI	CATG	4 cut(s)	225, 787, 960, 1075
FauI	CCCGC	3 cut(s)	143, 206, 371
FauNDI	CATATG	1 cut(s)	829
FokI	GGATG	5 cut(s)	523, 715, 952, 1071, 1144
FriOI	GRGCYC	2 cut(s)	110, 282
FspBI	CTAG	1 cut(s)	818
GlaI	GCGC	6 cut(s)	266, 318, 338, 354, 758, 763
GsaI	CCCAGC	1 cut(s)	741
HaeII	RGCGCY	1 cut(s)	268
HaeIII	GGCC	3 cut(s)	574, 750, 883
HapII	CCGG	5 cut(s)	320, 530, 554, 608, 1160
HgaI	GACGC	3 cut(s)	730, 1031, 1206
HhaI	GCGC	6 cut(s)	267, 319, 339, 355, 759, 764
Hin1II	CATG	4 cut(s)	229, 791, 964, 1079
Hin6I	GCGC	6 cut(s)	265, 317, 337, 353, 757, 762
HinP1I	GCGC	6 cut(s)	265, 317, 337, 353, 757, 762
HincII	GTYRAC	1 cut(s)	6
HindII	GTYRAC	1 cut(s)	6
HinfI	GANTC	3 cut(s)	41, 421, 455
HpaI	GTTAAC	1 cut(s)	6
HpaII	CCGG	5 cut(s)	320, 530, 554, 608, 1160
HphI	GGTGA	2 cut(s)	499, 882
Hpy166II	GTNNAC	2 cut(s)	6, 490
Hpy188I	TCNGA	8 cut(s)	301, 371, 399, 410, 460, 746, 879, 1096
Hpy188III	TCNNGA	7 cut(s)	103, 275, 392, 545, 788, 818, 1032
Hpy8I	GTNNAC	2 cut(s)	6, 490
Hpy99I	CGWCG	7 cut(s)	119, 122, 125, 254, 296, 616, 746
HpyAV	CCTTC	5 cut(s)	141, 232, 511, 1094, 1107
HpyCH4IV	ACGT	2 cut(s)	114, 360
HpyCH4V	TGCA	5 cut(s)	646, 666, 833, 842, 1079
HpyF10VI	GCNNNNNNNGC	9 cut(s)	273, 371, 652, 733, 747, 756, 839, 1059, 1068
HpyF3I	CTNAG	3 cut(s)	876, 1026, 1181
HpySE526I	ACGT	2 cut(s)	114, 360
Hsp92II	CATG	4 cut(s)	229, 791, 964, 1079
HspAI	GCGC	6 cut(s)	265, 317, 337, 353, 757, 762
KspAI	GTTAAC	1 cut(s)	6
Kzo9I	GATC	5 cut(s)	366, 394, 541, 637, 1091
LmnI	GCTCC	4 cut(s)	113, 189, 285, 322
Lsp1109I	GCAGC	7 cut(s)	711, 733, 766, 771, 854, 1181, 1203
LweI	GCATC	5 cut(s)	334, 653, 773, 793, 1049
MaeI	CTAG	1 cut(s)	818
MaeII	ACGT	2 cut(s)	114, 360
MaeIII	GTNAC	1 cut(s)	1043
MalI	GATC	5 cut(s)	368, 396, 543, 639, 1093
MbiI	CCGCTC	1 cut(s)	378
MboI	GATC	5 cut(s)	366, 394, 541, 637, 1091
MboII	GAAGA	5 cut(s)	190, 193, 484, 670, 1122
MflI	RGATCY	1 cut(s)	394
MhlI	GDGCHC	3 cut(s)	110, 282, 384
MluCI	AATT	3 cut(s)	58, 1086, 1172
MmeI	TCCRAC	6 cut(s)	324, 388, 519, 724, 990, 1007
MseI	TTAA	3 cut(s)	5, 1049, 1175
MspA1I	CMGCKG	3 cut(s)	484, 724, 1194
MspCI	CTTAAG	1 cut(s)	1048
MspI	CCGG	5 cut(s)	320, 530, 554, 608, 1160
MspR9I	CCNGG	3 cut(s)	554, 780, 1038
MteI	GCGCNGCGC	1 cut(s)	760
MvaI	CCWGG	2 cut(s)	780, 1038
MvnI	CGCG	5 cut(s)	125, 276, 317, 337, 353
MwoI	GCNNNNNNNGC	9 cut(s)	273, 371, 652, 733, 747, 756, 839, 1059, 1068
NciI	CCSGG	1 cut(s)	554
NdeI	CATATG	1 cut(s)	829
NdeII	GATC	5 cut(s)	366, 394, 541, 637, 1091
NlaIII	CATG	4 cut(s)	229, 791, 964, 1079
NlaIV	GGNNCC	5 cut(s)	129, 149, 480, 548, 850
NmuCI	GTSAC	1 cut(s)	1043
NruI	TCGCGA	1 cut(s)	276
NspI	RCATGY	1 cut(s)	1079
PaeI	GCATGC	1 cut(s)	1079
PagI	TCATGA	1 cut(s)	787
PasI	CCCWGGG	1 cut(s)	779
PcsI	WCGNNNNNNNCGW	1 cut(s)	357
PfeI	GAWTC	3 cut(s)	41, 421, 455
PflMI	CCANNNNNTGG	2 cut(s)	556, 908
PinAI	ACCGGT	1 cut(s)	1159
PmaCI	CACGTG	1 cut(s)	361
PmlI	CACGTG	1 cut(s)	361
Ppu21I	YACGTR	1 cut(s)	361
PshAI	GACNNNNGTC	1 cut(s)	258
Psp124BI	GAGCTC	2 cut(s)	110, 282
Psp6I	CCWGG	2 cut(s)	778, 1036
PspCI	CACGTG	1 cut(s)	361
PspFI	CCCAGC	1 cut(s)	737
PspGI	CCWGG	2 cut(s)	778, 1036
PspN4I	GGNNCC	5 cut(s)	129, 149, 480, 548, 850
PspPI	GGNCC	4 cut(s)	127, 547, 572, 693
PsuI	RGATCY	1 cut(s)	394
PvuII	CAGCTG	2 cut(s)	724, 1194
RruI	TCGCGA	1 cut(s)	276
RsaI	GTAC	1 cut(s)	344
RsaNI	GTAC	1 cut(s)	343
SacI	GAGCTC	2 cut(s)	110, 282
SaqAI	TTAA	3 cut(s)	5, 1049, 1175
Sau3AI	GATC	5 cut(s)	366, 394, 541, 637, 1091
Sau96I	GGNCC	4 cut(s)	127, 547, 572, 693
ScrFI	CCNGG	3 cut(s)	554, 780, 1038
SduI	GDGCHC	3 cut(s)	110, 282, 384
SfaNI	GCATC	5 cut(s)	334, 653, 773, 793, 1049
SinI	GGWCC	3 cut(s)	127, 547, 693
SmlI	CTYRAG	2 cut(s)	101, 1048
SmoI	CTYRAG	2 cut(s)	101, 1048
SphI	GCATGC	1 cut(s)	1079
Sse9I	AATT	3 cut(s)	58, 1086, 1172
SspMI	CTAG	1 cut(s)	818
SstI	GAGCTC	2 cut(s)	110, 282
StyD4I	CCNGG	3 cut(s)	552, 778, 1036
TaiI	ACGT	2 cut(s)	117, 363
TaqI	TCGA	1 cut(s)	1033
TasI	AATT	3 cut(s)	58, 1086, 1172
TauI	GCSGC	4 cut(s)	173, 213, 236, 484
TfiI	GAWTC	3 cut(s)	41, 421, 455
Tru1I	TTAA	3 cut(s)	5, 1049, 1175
Tru9I	TTAA	3 cut(s)	5, 1049, 1175
TscAI	CASTG	3 cut(s)	588, 1189, 1231
TseFI	GTSAC	1 cut(s)	1043
TseI	GCWGC	7 cut(s)	721, 724, 754, 759, 842, 1191, 1194
Tsp45I	GTSAC	1 cut(s)	1043
TspDTI	ATGAA	2 cut(s)	33, 214
TspGWI	ACGGA	4 cut(s)	467, 518, 630, 1168
TspRI	CASTG	3 cut(s)	588, 1189, 1231
Van91I	CCANNNNNTGG	2 cut(s)	556, 908
Vha464I	CTTAAG	1 cut(s)	1048
VpaK11BI	GGWCC	3 cut(s)	127, 547, 693
XbaI	TCTAGA	1 cut(s)	817
XceI	RCATGY	1 cut(s)	1079
XspI	CTAG	1 cut(s)	818

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.