Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002636.1

Orthogroup ID

OG0003409

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 2010

Gene Structure 2010 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002636.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 490 bp

atggacggcgtagctggcctgggctacttcgatttggccaaggaggagatcgccaaggctattagggctgaagaatggggcttaagatcgacgtcgacaacacagttaagattagtttctgcacttcttgctcttacaaatgaaacagctcggattctagttgagttcttggaggtggcaatcacatcaatcgttttcttcaaaggaatttatcctacaggactgcgagtgaggcatcaccaggagctcgaaaatttgacacttacgacgaggccggtaaagtcacagaaatatttcactgtggcaattggtcggtattttcggcaatttatggcaactggtggttcgtttgtgctgtttattatgctagcaggaggtctaggaattgctactatgacaattggcggaccacatgaaaaggagcttttctgttgtctgcaatttggactcttgtggctggctcttggtgtggcgtcatcaattggtcttg

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04140 map04140

Pfam Domains

Protein Families

No domains found.

Protein Analysis

163

Amino Acids

17.89

Weight (kDa)

8.64

Isoelectric Point (pI)

31.5

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003409)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G16590 AT1G16590
fragaria_vesca	FvH4_3g15651 FvH4_3g15651 FvH4_3g15651 FvH4_3g15651
malus_domestica	MD05G1220700.v1.1 MD10G1203100.v1.1 MD17G1180100.v1.1
prunus_persica	Prupe.4G139000_v2.0.a1 Prupe.4G139100_v2.0.a1 Prupe.4G141800_v2.0.a1 Prupe.4G141800_v2.0.a1
pyrus_communis	pycom10g17370
rosa_chinensis	RchiOBHm_Chr5g0026311 RchiOBHm_Chr5g0026331
rosa_multiflora	Rmu_sc0002636.1_g000001 Rmu_sc0003053.1_g000001 Rmu_sc0005764.1_g000001
rosa_roxburghii	Rroxscaffold_1G00053030
rosa_rugosa	Rorug05G0092300 Rorug05G0092300
rosa_samantha	Rh1AG339700 Rh4CG111000 Rh4CG215700 Rh5AG185300 Rh5BG182300 Rh5BG336900 Rh5CG201700 Rh5DG183900 Rh5DG184000 Rh6AG348500 Rh6DG077100
rosa_wichuraiana	Rw5G016820 Rw6G010600 Rw7G039410

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	95
AccI	GTMKAC	1 cut(s)	95
AciI	CCGC	1 cut(s)	405
AcoI	YGGCCR	1 cut(s)	36
AcsI	RAATTY	2 cut(s)	207, 253
AcuI	CTGAAG	1 cut(s)	90
AcyI	GRCGYC	2 cut(s)	92, 473
AflII	CTTAAG	1 cut(s)	82
AgsI	TTSAA	1 cut(s)	202
AjnI	CCWGG	2 cut(s)	18, 240
AluBI	AGCT	4 cut(s)	14, 149, 247, 424
AluI	AGCT	4 cut(s)	14, 149, 247, 424
Alw21I	GWGCWC	1 cut(s)	249
AoxI	GGCC	3 cut(s)	16, 36, 272
ApoI	RAATTY	2 cut(s)	207, 253
Asp700I	GAANNNNTTC	1 cut(s)	293
AspS9I	GGNCC	1 cut(s)	407
AsuHPI	GGTGA	1 cut(s)	230
AsuNHI	GCTAGC	1 cut(s)	367
AvaII	GGWCC	1 cut(s)	407
BalI	TGGCCA	1 cut(s)	38
BanII	GRGCYC	1 cut(s)	249
Bbv12I	GWGCWC	1 cut(s)	249
BceAI	ACGGC	1 cut(s)	22
BciT130I	CCWGG	2 cut(s)	20, 242
BfaI	CTAG	3 cut(s)	158, 368, 380
BfmI	CTRYAG	1 cut(s)	216
BfrI	CTTAAG	1 cut(s)	82
Bme1390I	CCNGG	2 cut(s)	20, 242
Bme18I	GGWCC	1 cut(s)	407
BmgT120I	GGNCC	1 cut(s)	407
BmrFI	CCNGG	2 cut(s)	20, 242
BmsI	GCATC	1 cut(s)	244
BmtI	GCTAGC	1 cut(s)	371
BsaHI	GRCGYC	2 cut(s)	92, 473
BsaJI	CCNNGG	3 cut(s)	19, 39, 54
Bse118I	RCCGGY	1 cut(s)	274
Bse1I	ACTGG	1 cut(s)	343
BseBI	CCWGG	2 cut(s)	20, 242
BseDI	CCNNGG	3 cut(s)	19, 39, 54
BseNI	ACTGG	1 cut(s)	343
BseRI	GAGGAG	1 cut(s)	59
BsgI	GTGCAG	1 cut(s)	105
BshFI	GGCC	3 cut(s)	18, 38, 274
BsiHKAI	GWGCWC	1 cut(s)	249
BsiSI	CCGG	1 cut(s)	275
BsnI	GGCC	3 cut(s)	18, 38, 274
Bsp1286I	GDGCHC	1 cut(s)	249
Bsp143I	GATC	2 cut(s)	48, 86
BspACI	CCGC	1 cut(s)	405
BspANI	GGCC	3 cut(s)	18, 38, 274
BspOI	GCTAGC	1 cut(s)	371
BspTI	CTTAAG	1 cut(s)	82
BsrFI	RCCGGY	1 cut(s)	274
BsrI	ACTGG	1 cut(s)	343
BssAI	RCCGGY	1 cut(s)	274
BssECI	CCNNGG	3 cut(s)	19, 39, 54
BssMI	GATC	2 cut(s)	48, 86
BssNI	GRCGYC	2 cut(s)	92, 473
BssT1I	CCWWGG	2 cut(s)	39, 54
Bst2UI	CCWGG	2 cut(s)	20, 242
Bst4CI	ACNGT	2 cut(s)	105, 301
BstACI	GRCGYC	2 cut(s)	92, 473
BstAFI	CTTAAG	1 cut(s)	82
BstAPI	GCANNNNNTGC	1 cut(s)	128
BstC8I	GCNNGC	3 cut(s)	16, 369, 459
BstKTI	GATC	2 cut(s)	51, 89
BstMBI	GATC	2 cut(s)	48, 86
BstMWI	GCNNNNNNNGC	4 cut(s)	15, 65, 128, 232
BstNI	CCWGG	2 cut(s)	20, 242
BstSCI	CCNGG	2 cut(s)	18, 240
BstSFI	CTRYAG	1 cut(s)	216
BsuRI	GGCC	3 cut(s)	18, 38, 274
BtsIMutI	CAGTG	1 cut(s)	297
Cac8I	GCNNGC	3 cut(s)	16, 369, 459
Cfr10I	RCCGGY	1 cut(s)	274
Cfr13I	GGNCC	1 cut(s)	407
CseI	GACGC	1 cut(s)	462
CviAII	CATG	1 cut(s)	413
DpnI	GATC	2 cut(s)	50, 88
DpnII	GATC	2 cut(s)	48, 86
EaeI	YGGCCR	1 cut(s)	36
EciI	GGCGGA	1 cut(s)	420
Ecl136II	GAGCTC	1 cut(s)	247
Eco130I	CCWWGG	2 cut(s)	39, 54
Eco24I	GRGCYC	1 cut(s)	249
Eco47I	GGWCC	1 cut(s)	407
Eco53kI	GAGCTC	1 cut(s)	247
Eco57I	CTGAAG	1 cut(s)	90
EcoICRI	GAGCTC	1 cut(s)	247
EcoRII	CCWGG	2 cut(s)	18, 240
EcoT14I	CCWWGG	2 cut(s)	39, 54
EcoT38I	GRGCYC	1 cut(s)	249
ErhI	CCWWGG	2 cut(s)	39, 54
FaeI	CATG	1 cut(s)	416
FaiI	YATR	4 cut(s)	332, 365, 395, 414
FatI	CATG	1 cut(s)	412
FblI	GTMKAC	1 cut(s)	95
FriOI	GRGCYC	1 cut(s)	249
FspBI	CTAG	3 cut(s)	158, 368, 380
HaeIII	GGCC	3 cut(s)	18, 38, 274
HapII	CCGG	1 cut(s)	275
HgaI	GACGC	1 cut(s)	462
Hin1I	GRCGYC	2 cut(s)	92, 473
Hin1II	CATG	1 cut(s)	416
HincII	GTYRAC	1 cut(s)	96
HindII	GTYRAC	1 cut(s)	96
HinfI	GANTC	2 cut(s)	154, 447
HpaII	CCGG	1 cut(s)	275
HphI	GGTGA	1 cut(s)	230
Hpy166II	GTNNAC	1 cut(s)	96
Hpy188I	TCNGA	1 cut(s)	153
Hpy8I	GTNNAC	1 cut(s)	96
Hpy99I	CGWCG	3 cut(s)	94, 97, 271
HpyCH4III	ACNGT	2 cut(s)	105, 301
HpyCH4IV	ACGT	1 cut(s)	92
HpyCH4V	TGCA	2 cut(s)	122, 439
HpyF10VI	GCNNNNNNNGC	4 cut(s)	15, 65, 128, 232
HpySE526I	ACGT	1 cut(s)	92
Hsp92I	GRCGYC	2 cut(s)	92, 473
Hsp92II	CATG	1 cut(s)	416
Kzo9I	GATC	2 cut(s)	48, 86
LmnI	GCTCC	2 cut(s)	244, 421
LpnPI	CCDG	9 cut(s)	5, 32, 204, 227, 254, 288, 324, 357, 443
LweI	GCATC	1 cut(s)	244
MaeI	CTAG	3 cut(s)	158, 368, 380
MaeII	ACGT	1 cut(s)	92
MaeIII	GTNAC	1 cut(s)	282
MalI	GATC	2 cut(s)	50, 88
MboI	GATC	2 cut(s)	48, 86
MboII	GAAGA	2 cut(s)	83, 190
MfeI	CAATTG	3 cut(s)	306, 399, 480
MhlI	GDGCHC	1 cut(s)	249
MlsI	TGGCCA	1 cut(s)	38
MluCI	AATT	8 cut(s)	207, 253, 306, 326, 384, 399, 440, 480
MluNI	TGGCCA	1 cut(s)	38
MlyI	GAGTC	1 cut(s)	441
MnlI	CCTC	5 cut(s)	37, 166, 225, 264, 368
Mox20I	TGGCCA	1 cut(s)	38
MroXI	GAANNNNTTC	1 cut(s)	293
MscI	TGGCCA	1 cut(s)	38
MseI	TTAA	2 cut(s)	83, 107
Msp20I	TGGCCA	1 cut(s)	38
MspCI	CTTAAG	1 cut(s)	82
MspI	CCGG	1 cut(s)	275
MspR9I	CCNGG	2 cut(s)	20, 242
MunI	CAATTG	3 cut(s)	306, 399, 480
MvaI	CCWGG	2 cut(s)	20, 242
MwoI	GCNNNNNNNGC	4 cut(s)	15, 65, 128, 232
NdeII	GATC	2 cut(s)	48, 86
NheI	GCTAGC	1 cut(s)	367
NlaIII	CATG	1 cut(s)	416
NmuCI	GTSAC	1 cut(s)	282
PdmI	GAANNNNTTC	1 cut(s)	293
PfeI	GAWTC	1 cut(s)	154
PleI	GAGTC	1 cut(s)	441
PpsI	GAGTC	1 cut(s)	441
Psp124BI	GAGCTC	1 cut(s)	249
Psp6I	CCWGG	2 cut(s)	18, 240
PspGI	CCWGG	2 cut(s)	18, 240
PspPI	GGNCC	1 cut(s)	407
SacI	GAGCTC	1 cut(s)	249
SalI	GTCGAC	1 cut(s)	94
SaqAI	TTAA	2 cut(s)	83, 107
Sau3AI	GATC	2 cut(s)	48, 86
Sau96I	GGNCC	1 cut(s)	407
SchI	GAGTC	1 cut(s)	441
ScrFI	CCNGG	2 cut(s)	20, 242
SduI	GDGCHC	1 cut(s)	249
SetI	ASST	7 cut(s)	16, 95, 151, 177, 249, 379, 426
SfaNI	GCATC	1 cut(s)	244
SfcI	CTRYAG	1 cut(s)	216
SinI	GGWCC	1 cut(s)	407
SmlI	CTYRAG	1 cut(s)	82
SmoI	CTYRAG	1 cut(s)	82
Sse9I	AATT	8 cut(s)	207, 253, 306, 326, 384, 399, 440, 480
SsiI	CCGC	1 cut(s)	405
SspI	AATATT	1 cut(s)	293
SspMI	CTAG	3 cut(s)	158, 368, 380
SstI	GAGCTC	1 cut(s)	249
StyD4I	CCNGG	2 cut(s)	18, 240
StyI	CCWWGG	2 cut(s)	39, 54
TaaI	ACNGT	2 cut(s)	105, 301
TaiI	ACGT	1 cut(s)	95
TaqI	TCGA	4 cut(s)	30, 89, 95, 249
TasI	AATT	8 cut(s)	207, 253, 306, 326, 384, 399, 440, 480
TfiI	GAWTC	1 cut(s)	154
Tru1I	TTAA	2 cut(s)	83, 107
Tru9I	TTAA	2 cut(s)	83, 107
TscAI	CASTG	1 cut(s)	304
TseFI	GTSAC	1 cut(s)	282
Tsp45I	GTSAC	1 cut(s)	282
TspDTI	ATGAA	2 cut(s)	156, 429
TspRI	CASTG	1 cut(s)	304
Vha464I	CTTAAG	1 cut(s)	82
VpaK11BI	GGWCC	1 cut(s)	407
XapI	RAATTY	2 cut(s)	207, 253
XmiI	GTMKAC	1 cut(s)	95
XmnI	GAANNNNTTC	1 cut(s)	293
XspI	CTAG	3 cut(s)	158, 368, 380
ZraI	GACGTC	1 cut(s)	93

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.