Rh4CG111000

DNA polymerase zeta processivity

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Reverse (-)
20878207 .. 20879559
1353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG111000.1

Sequence Viewer

Length: 258 bp
ATGGACGGCGTAGCTGGCCTGGGCTACTTCGATTTGGCCAAGGGGGAGATCGCCAAGGCTATTAGGGCTGAAGAATGGGGCTTAAGATCGACGTCGACAACACAGTTAAGATTAGTTTCTGCACTTCTTGCTCTTACAAATGAAACCGCTCGGATTCTAGTTGAGTTCTTGGAGGTGGCAATCACATCAATCGTTTTCTTCAAAGGAATTTATCCTACAGGACTTGCTGGATATGCGGCCTTAAATGCAGCCAAATAA

Protein Analysis

85

Amino Acids

9.05

Weight (kDa)

6.17

Isoelectric Point (pI)

18.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 95
AccBSI CCGCTC 1 cut(s) 149
AccI GTMKAC 1 cut(s) 95
AciI CCGC 2 cut(s) 147, 236
AcoI YGGCCR 1 cut(s) 36
AcsI RAATTY 1 cut(s) 207
AcuI CTGAAG 1 cut(s) 90
AcyI GRCGYC 1 cut(s) 92
AflII CTTAAG 1 cut(s) 82
AgsI TTSAA 1 cut(s) 202
AjnI CCWGG 1 cut(s) 18
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
AoxI GGCC 3 cut(s) 16, 36, 237
ApeKI GCWGC 1 cut(s) 248
ApoI RAATTY 1 cut(s) 207
BalI TGGCCA 1 cut(s) 38
BceAI ACGGC 1 cut(s) 22
BciT130I CCWGG 1 cut(s) 20
BfaI CTAG 1 cut(s) 158
BfmI CTRYAG 1 cut(s) 216
BfrI CTTAAG 1 cut(s) 82
BisI GCNGC 2 cut(s) 237, 249
BlsI GCNGC 2 cut(s) 238, 250
Bme1390I CCNGG 1 cut(s) 20
BmrFI CCNGG 1 cut(s) 20
BsaHI GRCGYC 1 cut(s) 92
BsaJI CCNNGG 3 cut(s) 19, 39, 54
BseBI CCWGG 1 cut(s) 20
BseDI CCNNGG 3 cut(s) 19, 39, 54
BsgI GTGCAG 1 cut(s) 105
BshFI GGCC 3 cut(s) 18, 38, 239
BsnI GGCC 3 cut(s) 18, 38, 239
Bsp143I GATC 2 cut(s) 48, 86
BspACI CCGC 2 cut(s) 147, 236
BspANI GGCC 3 cut(s) 18, 38, 239
BspTI CTTAAG 1 cut(s) 82
BsrBI CCGCTC 1 cut(s) 149
BssECI CCNNGG 3 cut(s) 19, 39, 54
BssMI GATC 2 cut(s) 48, 86
BssNI GRCGYC 1 cut(s) 92
BssT1I CCWWGG 2 cut(s) 39, 54
Bst2UI CCWGG 1 cut(s) 20
Bst4CI ACNGT 1 cut(s) 105
BstACI GRCGYC 1 cut(s) 92
BstAFI CTTAAG 1 cut(s) 82
BstAPI GCANNNNNTGC 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 16
BstKTI GATC 2 cut(s) 51, 89
BstMBI GATC 2 cut(s) 48, 86
BstMWI GCNNNNNNNGC 5 cut(s) 15, 65, 128, 233, 245
BstNI CCWGG 1 cut(s) 20
BstSCI CCNGG 1 cut(s) 18
BstSFI CTRYAG 1 cut(s) 216
BsuRI GGCC 3 cut(s) 18, 38, 239
Cac8I GCNNGC 1 cut(s) 16
CviJI RGCY 9 cut(s) 14, 18, 24, 38, 59, 68, 81, 239, 251
CviKI_1 RGCY 9 cut(s) 14, 18, 24, 38, 59, 68, 81, 239, 251
DpnI GATC 2 cut(s) 50, 88
DpnII GATC 2 cut(s) 48, 86
EaeI YGGCCR 1 cut(s) 36
Eco130I CCWWGG 2 cut(s) 39, 54
Eco57I CTGAAG 1 cut(s) 90
EcoRII CCWGG 1 cut(s) 18
EcoT14I CCWWGG 2 cut(s) 39, 54
ErhI CCWWGG 2 cut(s) 39, 54
FaiI YATR 1 cut(s) 234
FblI GTMKAC 1 cut(s) 95
Fnu4HI GCNGC 2 cut(s) 237, 249
Fsp4HI GCNGC 2 cut(s) 237, 249
FspBI CTAG 1 cut(s) 158
GluI GCNGC 2 cut(s) 237, 249
HaeIII GGCC 3 cut(s) 18, 38, 239
Hin1I GRCGYC 1 cut(s) 92
HincII GTYRAC 1 cut(s) 96
HindII GTYRAC 1 cut(s) 96
HinfI GANTC 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 153
Hpy8I GTNNAC 1 cut(s) 96
Hpy99I CGWCG 2 cut(s) 94, 97
HpyCH4III ACNGT 1 cut(s) 105
HpyCH4IV ACGT 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 122, 248
HpyF10VI GCNNNNNNNGC 5 cut(s) 15, 65, 128, 233, 245
HpySE526I ACGT 1 cut(s) 92
Hsp92I GRCGYC 1 cut(s) 92
Kzo9I GATC 2 cut(s) 48, 86
LpnPI CCDG 4 cut(s) 5, 32, 204, 213
MaeI CTAG 1 cut(s) 158
MaeII ACGT 1 cut(s) 92
MalI GATC 2 cut(s) 50, 88
MbiI CCGCTC 1 cut(s) 149
MboI GATC 2 cut(s) 48, 86
MboII GAAGA 2 cut(s) 83, 190
MlsI TGGCCA 1 cut(s) 38
MluCI AATT 1 cut(s) 207
MluNI TGGCCA 1 cut(s) 38
MnlI CCTC 1 cut(s) 166
Mox20I TGGCCA 1 cut(s) 38
MscI TGGCCA 1 cut(s) 38
MseI TTAA 3 cut(s) 83, 107, 242
Msp20I TGGCCA 1 cut(s) 38
MspCI CTTAAG 1 cut(s) 82
MspR9I CCNGG 1 cut(s) 20
MvaI CCWGG 1 cut(s) 20
MwoI GCNNNNNNNGC 5 cut(s) 15, 65, 128, 233, 245
NdeII GATC 2 cut(s) 48, 86
PfeI GAWTC 1 cut(s) 154
PkrI GCNGC 2 cut(s) 238, 250
Psp6I CCWGG 1 cut(s) 18
PspGI CCWGG 1 cut(s) 18
SalI GTCGAC 1 cut(s) 94
SaqAI TTAA 3 cut(s) 83, 107, 242
SatI GCNGC 2 cut(s) 237, 249
Sau3AI GATC 2 cut(s) 48, 86
ScrFI CCNGG 1 cut(s) 20
SetI ASST 3 cut(s) 16, 95, 177
SfcI CTRYAG 1 cut(s) 216
SmlI CTYRAG 1 cut(s) 82
SmoI CTYRAG 1 cut(s) 82
Sse9I AATT 1 cut(s) 207
SsiI CCGC 2 cut(s) 147, 236
SspMI CTAG 1 cut(s) 158
StyD4I CCNGG 1 cut(s) 18
StyI CCWWGG 2 cut(s) 39, 54
TaaI ACNGT 1 cut(s) 105
TaiI ACGT 1 cut(s) 95
TaqI TCGA 3 cut(s) 30, 89, 95
TasI AATT 1 cut(s) 207
TauI GCSGC 1 cut(s) 239
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 3 cut(s) 83, 107, 242
Tru9I TTAA 3 cut(s) 83, 107, 242
TseI GCWGC 1 cut(s) 248
TspDTI ATGAA 1 cut(s) 156
Vha464I CTTAAG 1 cut(s) 82
XapI RAATTY 1 cut(s) 207
XmiI GTMKAC 1 cut(s) 95
XspI CTAG 1 cut(s) 158
ZraI GACGTC 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.