Rmu_sc0002833.1_g000019

Ataxin 2 SM domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002833.1
OG0001651
Physical Location & Seq
Reverse (-)
81288 .. 81607
320 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002833.1_g000019.1.cds

Sequence Viewer

Length: 228 bp
atgactaaaaagggaaaatatgatgcgaatgtagcaaatggggagttgatagatactcttgtgattctttctggtgaccttgtccaagttgttacaaagggagttttacttccagctgatggtgttgctggaaatatgtctggtgatagaactgaagctgttatgggtactgtttcttcttatgagtgttcaaagaatggtgcgaagaagtcaagtgatctgccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PAM2 SM-ATX

Protein Analysis

75

Amino Acids

7.72

Weight (kDa)

5.13

Isoelectric Point (pI)

23.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 119
AcuI CTGAAG 1 cut(s) 174
AfaI GTAC 1 cut(s) 169
AfiI CCNNNNNNNGG 1 cut(s) 119
AgsI TTSAA 1 cut(s) 192
AluBI AGCT 2 cut(s) 116, 158
AluI AGCT 2 cut(s) 116, 158
AsuHPI GGTGA 2 cut(s) 86, 155
BaeI ACNNNNGTAYC 2 cut(s) 45, 78
BarI GAAGNNNNNNTAC 2 cut(s) 160, 192
BccI CCATC 1 cut(s) 113
BmsI GCATC 1 cut(s) 13
Bsc4I CCNNNNNNNGG 1 cut(s) 119
BseLI CCNNNNNNNGG 1 cut(s) 119
BslI CCNNNNNNNGG 1 cut(s) 119
Bsp143I GATC 1 cut(s) 217
BssMI GATC 1 cut(s) 217
Bst4CI ACNGT 1 cut(s) 172
BstEII GGTNACC 1 cut(s) 74
BstKTI GATC 1 cut(s) 220
BstMBI GATC 1 cut(s) 217
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstPI GGTNACC 1 cut(s) 74
Csp6I GTAC 1 cut(s) 168
CviJI RGCY 2 cut(s) 116, 158
CviKI_1 RGCY 2 cut(s) 116, 158
CviQI GTAC 1 cut(s) 168
DpnI GATC 1 cut(s) 219
DpnII GATC 1 cut(s) 217
Eco57I CTGAAG 1 cut(s) 174
Eco91I GGTNACC 1 cut(s) 74
EcoO65I GGTNACC 1 cut(s) 74
FaiI YATR 5 cut(s) 21, 137, 164, 183, 226
HinfI GANTC 1 cut(s) 64
HphI GGTGA 2 cut(s) 86, 155
HpyCH4III ACNGT 1 cut(s) 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
Kzo9I GATC 1 cut(s) 217
LpnPI CCDG 4 cut(s) 57, 114, 126, 126
LweI GCATC 1 cut(s) 13
MaeIII GTNAC 2 cut(s) 74, 91
MalI GATC 1 cut(s) 219
MboI GATC 1 cut(s) 217
MboII GAAGA 2 cut(s) 168, 217
MspA1I CMGCKG 1 cut(s) 116
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeII GATC 1 cut(s) 217
NmuCI GTSAC 1 cut(s) 74
PfeI GAWTC 1 cut(s) 64
PflFI GACNNNGTC 1 cut(s) 80
PflMI CCANNNNNTGG 1 cut(s) 119
PspEI GGTNACC 1 cut(s) 74
PsyI GACNNNGTC 1 cut(s) 80
PvuII CAGCTG 1 cut(s) 116
RsaI GTAC 1 cut(s) 169
RsaNI GTAC 1 cut(s) 168
Sau3AI GATC 1 cut(s) 217
SetI ASST 3 cut(s) 81, 118, 160
SfaNI GCATC 1 cut(s) 13
SgeI CNNG 7 cut(s) 71, 84, 92, 98, 125, 141, 153
TaaI ACNGT 1 cut(s) 172
TfiI GAWTC 1 cut(s) 64
TseFI GTSAC 1 cut(s) 74
Tsp45I GTSAC 1 cut(s) 74
Tth111I GACNNNGTC 1 cut(s) 80
Van91I CCANNNNNTGG 1 cut(s) 119
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.