Rh3AG070700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0001651
Physical Location & Seq
Forward (+)
5144623 .. 5145196
574 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG070700.1

Sequence Viewer

Length: 159 bp
ATGGATACAAACAAGTCTTGCTCCTGGTTCTGGCGTTTTAACCAAATAACTGCTTCAGAGAATGTTAAGGACCACCAGAGGTTTACCAATGCAGAAAAGATGAGCCTGAATGACAGGCAACTTGCTGCACAGCTTATTCAGAGGGTGCTAGATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.17

Weight (kDa)

7.96

Isoelectric Point (pI)

34.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 39
AfiI CCNNNNNNNGG 1 cut(s) 30
AjnI CCWGG 1 cut(s) 23
AluBI AGCT 1 cut(s) 133
AluI AGCT 1 cut(s) 133
ApeKI GCWGC 1 cut(s) 125
AspS9I GGNCC 1 cut(s) 70
AvaII GGWCC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 112
BciT130I CCWGG 1 cut(s) 25
BfaI CTAG 1 cut(s) 149
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme1390I CCNGG 1 cut(s) 25
Bme18I GGWCC 1 cut(s) 70
BmgT120I GGNCC 1 cut(s) 70
BmrFI CCNGG 1 cut(s) 25
Bsc4I CCNNNNNNNGG 1 cut(s) 30
BseBI CCWGG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 30
BseXI GCAGC 1 cut(s) 112
BsgI GTGCAG 1 cut(s) 111
BslI CCNNNNNNNGG 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 25
BstNI CCWGG 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 23
BstV1I GCAGC 1 cut(s) 112
Cfr13I GGNCC 1 cut(s) 70
CviJI RGCY 2 cut(s) 105, 133
CviKI_1 RGCY 2 cut(s) 105, 133
Eco47I GGWCC 1 cut(s) 70
Eco57I CTGAAG 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 23
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 1 cut(s) 149
GluI GCNGC 1 cut(s) 126
HinfI GANTC 1 cut(s) 152
Hpy166II GTNNAC 1 cut(s) 84
Hpy188I TCNGA 2 cut(s) 58, 141
Hpy188III TCNNGA 1 cut(s) 156
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 92, 128
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 6 cut(s) 10, 16, 37, 89, 100, 119
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 1 cut(s) 149
MnlI CCTC 2 cut(s) 72, 135
MseI TTAA 2 cut(s) 39, 66
MspR9I CCNGG 1 cut(s) 25
MvaI CCWGG 1 cut(s) 25
PfeI GAWTC 1 cut(s) 152
PkrI GCNGC 1 cut(s) 127
Psp6I CCWGG 1 cut(s) 23
PspGI CCWGG 1 cut(s) 23
PspPI GGNCC 1 cut(s) 70
SaqAI TTAA 2 cut(s) 39, 66
SatI GCNGC 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 25
SetI ASST 2 cut(s) 83, 135
SgeI CNNG 9 cut(s) 25, 30, 36, 37, 43, 88, 118, 127, 134
SinI GGWCC 1 cut(s) 70
SspMI CTAG 1 cut(s) 149
StyD4I CCNGG 1 cut(s) 23
TfiI GAWTC 1 cut(s) 152
Tru1I TTAA 2 cut(s) 39, 66
Tru9I TTAA 2 cut(s) 39, 66
TseI GCWGC 1 cut(s) 125
VpaK11BI GGWCC 1 cut(s) 70
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.