Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003122.1

Orthogroup ID

OG0002544

Physical Location & Seq

Genomic Coordinates Reverse (-)

8233 .. 8529

Gene Structure 297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003122.1_g000003.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 297 bp

atggaattgaataacaaacttaaccatgagttaaacaagcttggaatagagataatggagctcagagaggagttgtctgacttggagaagatccacaagcaacagattcaagaaaatgagaacgcatattgcgcagggttcctgactagttggttcaaggagcctcatgccaacattgccctgccaagccatgaggccaaggacgttgctcttctagatcatgaacttctggaggccctatctccactctttcacacttctgccttaattaaaattttcgaaagtactgatccatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

98

Amino Acids

11.25

Weight (kDa)

4.87

Isoelectric Point (pI)

45.82

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002544)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g36370 FvH4_3g36370 FvH4_3g36370 FvH4_3g36370
rosa_chinensis	RchiOBHm_Chr5g0065181 RchiOBHm_Chr5g0065201 RchiOBHm_Chr5g0065211
rosa_laevigata	RLG00000035765 RLG00000035766 RLG00000035768 RLG00000035769
rosa_multiflora	Rmu_co8107252.1_g000001 Rmu_sc0000956.1_g000008 Rmu_sc0003122.1_g000003 Rmu_sc0003122.1_g000004 Rmu_sc0005450.1_g000014 Rmu_sc0028188.1_g000001
rosa_roxburghii	Rroxscaffold_1G00016090 Rroxscaffold_1G00016100 Rroxscaffold_1G00016130
rosa_rugosa	Rorug05G0369200 Rorug05G0369300 Rorug05G0369400 Rorug05G0369400 Rorug05G0369400
rosa_samantha	Rh5AG427300 Rh5AG427800 Rh5AG427900 Rh5BG442400 Rh5BG443000 Rh5BG443100 Rh5CG464900 Rh5CG465300 Rh5CG465400 Rh5DG455000 Rh5DG455100 Rh5DG455500 Rh5DG455600
rosa_wichuraiana	Rw5G040120 Rw5G040140 Rw5G040150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	133
AclWI	GGATC	2 cut(s)	85, 284
AcsI	RAATTY	1 cut(s)	273
AfaI	GTAC	1 cut(s)	286
AgsI	TTSAA	3 cut(s)	10, 110, 157
AhlI	ACTAGT	1 cut(s)	146
AluBI	AGCT	2 cut(s)	40, 61
AluI	AGCT	2 cut(s)	40, 61
Alw21I	GWGCWC	1 cut(s)	63
AlwI	GGATC	2 cut(s)	85, 284
AoxI	GGCC	2 cut(s)	195, 234
ApoI	RAATTY	1 cut(s)	273
AspLEI	GCGC	1 cut(s)	134
AspS9I	GGNCC	1 cut(s)	235
AsuII	TTCGAA	1 cut(s)	279
BanII	GRGCYC	1 cut(s)	63
Bbv12I	GWGCWC	1 cut(s)	63
BcuI	ACTAGT	1 cut(s)	146
BfaI	CTAG	2 cut(s)	147, 215
BmcAI	AGTACT	1 cut(s)	286
BmgT120I	GGNCC	1 cut(s)	235
BmiI	GGNNCC	2 cut(s)	140, 162
BpmI	CTGGAG	1 cut(s)	251
Bpu14I	TTCGAA	1 cut(s)	279
BsaJI	CCNNGG	1 cut(s)	198
Bse3DI	GCAATG	1 cut(s)	174
BseDI	CCNNGG	1 cut(s)	198
BseMI	GCAATG	1 cut(s)	174
BseMII	CTCAG	1 cut(s)	76
BseRI	GAGGAG	1 cut(s)	83
BshFI	GGCC	2 cut(s)	197, 236
BsiHKAI	GWGCWC	1 cut(s)	63
BsnI	GGCC	2 cut(s)	197, 236
Bsp119I	TTCGAA	1 cut(s)	279
Bsp1286I	GDGCHC	1 cut(s)	63
Bsp143I	GATC	3 cut(s)	90, 217, 289
BspANI	GGCC	2 cut(s)	197, 236
BspCNI	CTCAG	1 cut(s)	75
BspHI	TCATGA	1 cut(s)	220
BspLI	GGNNCC	2 cut(s)	140, 162
BspPI	GGATC	2 cut(s)	85, 284
BspQI	GCTCTTC	1 cut(s)	216
BspT104I	TTCGAA	1 cut(s)	279
BsrDI	GCAATG	1 cut(s)	174
BssECI	CCNNGG	1 cut(s)	198
BssMI	GATC	3 cut(s)	90, 217, 289
BssT1I	CCWWGG	1 cut(s)	198
Bst6I	CTCTTC	1 cut(s)	216
BstBI	TTCGAA	1 cut(s)	279
BstDEI	CTNAG	1 cut(s)	62
BstHHI	GCGC	1 cut(s)	134
BstKTI	GATC	3 cut(s)	93, 220, 292
BstMBI	GATC	3 cut(s)	90, 217, 289
BstMWI	GCNNNNNNNGC	2 cut(s)	131, 176
BstX2I	RGATCY	1 cut(s)	90
BstYI	RGATCY	1 cut(s)	90
BsuRI	GGCC	2 cut(s)	197, 236
CciI	TCATGA	1 cut(s)	220
CfoI	GCGC	1 cut(s)	134
Cfr13I	GGNCC	1 cut(s)	235
Csp6I	GTAC	1 cut(s)	285
CviAII	CATG	4 cut(s)	26, 167, 191, 221
CviJI	RGCY	6 cut(s)	40, 61, 163, 189, 197, 236
CviKI_1	RGCY	6 cut(s)	40, 61, 163, 189, 197, 236
CviQI	GTAC	1 cut(s)	285
DdeI	CTNAG	1 cut(s)	62
DpnI	GATC	3 cut(s)	92, 219, 291
DpnII	GATC	3 cut(s)	90, 217, 289
Eam1104I	CTCTTC	1 cut(s)	216
EarI	CTCTTC	1 cut(s)	216
Ecl136II	GAGCTC	1 cut(s)	61
Eco130I	CCWWGG	1 cut(s)	198
Eco24I	GRGCYC	1 cut(s)	63
Eco53kI	GAGCTC	1 cut(s)	61
EcoICRI	GAGCTC	1 cut(s)	61
EcoO109I	RGGNCCY	1 cut(s)	235
EcoT14I	CCWWGG	1 cut(s)	198
EcoT38I	GRGCYC	1 cut(s)	63
ErhI	CCWWGG	1 cut(s)	198
FaeI	CATG	4 cut(s)	29, 170, 194, 224
FaiI	YATR	6 cut(s)	27, 127, 168, 192, 222, 295
FatI	CATG	4 cut(s)	25, 166, 190, 220
FriOI	GRGCYC	1 cut(s)	63
FspBI	CTAG	2 cut(s)	147, 215
FspI	TGCGCA	1 cut(s)	133
GlaI	GCGC	1 cut(s)	133
GsuI	CTGGAG	1 cut(s)	251
HaeIII	GGCC	2 cut(s)	197, 236
HhaI	GCGC	1 cut(s)	134
Hin1II	CATG	4 cut(s)	29, 170, 194, 224
Hin6I	GCGC	1 cut(s)	132
HinP1I	GCGC	1 cut(s)	132
HindIII	AAGCTT	1 cut(s)	38
HinfI	GANTC	1 cut(s)	106
Hpy188I	TCNGA	2 cut(s)	65, 79
Hpy188III	TCNNGA	5 cut(s)	110, 142, 215, 221, 230
HpyCH4IV	ACGT	1 cut(s)	204
HpyF10VI	GCNNNNNNNGC	2 cut(s)	131, 176
HpyF3I	CTNAG	1 cut(s)	62
HpySE526I	ACGT	1 cut(s)	204
Hsp92II	CATG	4 cut(s)	29, 170, 194, 224
HspAI	GCGC	1 cut(s)	132
Kzo9I	GATC	3 cut(s)	90, 217, 289
LguI	GCTCTTC	1 cut(s)	216
LmnI	GCTCC	2 cut(s)	58, 160
LpnPI	CCDG	4 cut(s)	120, 155, 194, 215
MaeI	CTAG	2 cut(s)	147, 215
MaeII	ACGT	1 cut(s)	204
MalI	GATC	3 cut(s)	92, 219, 291
MboI	GATC	3 cut(s)	90, 217, 289
MboII	GAAGA	2 cut(s)	100, 203
MflI	RGATCY	1 cut(s)	90
MhlI	GDGCHC	1 cut(s)	63
MluCI	AATT	3 cut(s)	5, 267, 273
MnlI	CCTC	4 cut(s)	61, 174, 187, 226
MseI	TTAA	4 cut(s)	21, 32, 266, 270
MwoI	GCNNNNNNNGC	2 cut(s)	131, 176
NdeII	GATC	3 cut(s)	90, 217, 289
NlaIII	CATG	4 cut(s)	29, 170, 194, 224
NlaIV	GGNNCC	2 cut(s)	140, 162
NsbI	TGCGCA	1 cut(s)	133
NspV	TTCGAA	1 cut(s)	279
PacI	TTAATTAA	1 cut(s)	270
PagI	TCATGA	1 cut(s)	220
PciSI	GCTCTTC	1 cut(s)	216
PfeI	GAWTC	1 cut(s)	106
Psp124BI	GAGCTC	1 cut(s)	63
PspN4I	GGNNCC	2 cut(s)	140, 162
PspPI	GGNCC	1 cut(s)	235
PsuI	RGATCY	1 cut(s)	90
RsaI	GTAC	1 cut(s)	286
RsaNI	GTAC	1 cut(s)	285
SacI	GAGCTC	1 cut(s)	63
SapI	GCTCTTC	1 cut(s)	216
SaqAI	TTAA	4 cut(s)	21, 32, 266, 270
Sau3AI	GATC	3 cut(s)	90, 217, 289
Sau96I	GGNCC	1 cut(s)	235
ScaI	AGTACT	1 cut(s)	286
SduI	GDGCHC	1 cut(s)	63
SetI	ASST	3 cut(s)	42, 63, 207
SfuI	TTCGAA	1 cut(s)	279
SpeI	ACTAGT	1 cut(s)	146
Sse9I	AATT	3 cut(s)	5, 267, 273
SspMI	CTAG	2 cut(s)	147, 215
SstI	GAGCTC	1 cut(s)	63
StyI	CCWWGG	1 cut(s)	198
TaiI	ACGT	1 cut(s)	207
TaqI	TCGA	1 cut(s)	279
TasI	AATT	3 cut(s)	5, 267, 273
TatI	WGTACW	1 cut(s)	284
TfiI	GAWTC	1 cut(s)	106
Tru1I	TTAA	4 cut(s)	21, 32, 266, 270
Tru9I	TTAA	4 cut(s)	21, 32, 266, 270
TspDTI	ATGAA	1 cut(s)	237
XapI	RAATTY	1 cut(s)	273
XbaI	TCTAGA	1 cut(s)	214
XspI	CTAG	2 cut(s)	147, 215
ZrmI	AGTACT	1 cut(s)	286

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.