Rh5DG455100

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
72498711 .. 72507757
9047 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG455100.1

Sequence Viewer

Length: 270 bp
ATGGAATTGAATAACAAACTTAACCATGAGTTAAACAAGCTTGGAATAGAGATAATGGAGCTCAGAGAGGAGTTGTCTGACTTGGAGAAGATCCACAAGCAACAGATTCAAGAAAATGAGAACGCATATTGCGCAGGGTTCCTGACTAGTTGGTTCAAGGAGCCTCATGCCAACATTGCCCTGCCAAGCCATGAGGCCAAGGACTTACTACAAATTGAAGCTTCAACATTCATTGCACGTTTATACACTAAAAGAGGAAACCCTCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

10.36

Weight (kDa)

5.68

Isoelectric Point (pI)

55.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 133
AclWI GGATC 1 cut(s) 85
AgsI TTSAA 5 cut(s) 10, 110, 157, 218, 225
AhlI ACTAGT 1 cut(s) 146
AluBI AGCT 3 cut(s) 40, 61, 221
AluI AGCT 3 cut(s) 40, 61, 221
Alw21I GWGCWC 1 cut(s) 63
AlwI GGATC 1 cut(s) 85
AoxI GGCC 1 cut(s) 195
AspLEI GCGC 1 cut(s) 134
BanII GRGCYC 1 cut(s) 63
Bbv12I GWGCWC 1 cut(s) 63
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 1 cut(s) 147
BmiI GGNNCC 2 cut(s) 140, 162
BsaJI CCNNGG 1 cut(s) 198
Bse3DI GCAATG 2 cut(s) 174, 231
BseDI CCNNGG 1 cut(s) 198
BseMI GCAATG 2 cut(s) 174, 231
BseMII CTCAG 1 cut(s) 76
BseRI GAGGAG 1 cut(s) 83
BshFI GGCC 1 cut(s) 197
BsiHKAI GWGCWC 1 cut(s) 63
BsnI GGCC 1 cut(s) 197
Bsp1286I GDGCHC 1 cut(s) 63
Bsp143I GATC 1 cut(s) 90
BspANI GGCC 1 cut(s) 197
BspCNI CTCAG 1 cut(s) 75
BspLI GGNNCC 2 cut(s) 140, 162
BspPI GGATC 1 cut(s) 85
BsrDI GCAATG 2 cut(s) 174, 231
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 1 cut(s) 90
BssT1I CCWWGG 1 cut(s) 198
BstDEI CTNAG 1 cut(s) 62
BstHHI GCGC 1 cut(s) 134
BstKTI GATC 1 cut(s) 93
BstMBI GATC 1 cut(s) 90
BstMWI GCNNNNNNNGC 2 cut(s) 131, 176
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
BsuRI GGCC 1 cut(s) 197
CfoI GCGC 1 cut(s) 134
CviAII CATG 3 cut(s) 26, 167, 191
CviJI RGCY 6 cut(s) 40, 61, 163, 189, 197, 221
CviKI_1 RGCY 6 cut(s) 40, 61, 163, 189, 197, 221
DdeI CTNAG 1 cut(s) 62
DpnI GATC 1 cut(s) 92
DpnII GATC 1 cut(s) 90
Ecl136II GAGCTC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 198
Eco24I GRGCYC 1 cut(s) 63
Eco53kI GAGCTC 1 cut(s) 61
EcoICRI GAGCTC 1 cut(s) 61
EcoT14I CCWWGG 1 cut(s) 198
EcoT38I GRGCYC 1 cut(s) 63
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 3 cut(s) 29, 170, 194
FaiI YATR 5 cut(s) 27, 127, 168, 192, 244
FatI CATG 3 cut(s) 25, 166, 190
FriOI GRGCYC 1 cut(s) 63
FspBI CTAG 1 cut(s) 147
FspI TGCGCA 1 cut(s) 133
GlaI GCGC 1 cut(s) 133
HaeIII GGCC 1 cut(s) 197
HhaI GCGC 1 cut(s) 134
Hin1II CATG 3 cut(s) 29, 170, 194
Hin6I GCGC 1 cut(s) 132
HinP1I GCGC 1 cut(s) 132
HindIII AAGCTT 2 cut(s) 38, 219
HinfI GANTC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 65, 79
Hpy188III TCNNGA 2 cut(s) 110, 142
HpyCH4IV ACGT 1 cut(s) 238
HpyCH4V TGCA 1 cut(s) 236
HpyF10VI GCNNNNNNNGC 2 cut(s) 131, 176
HpyF3I CTNAG 1 cut(s) 62
HpySE526I ACGT 1 cut(s) 238
Hsp92II CATG 3 cut(s) 29, 170, 194
HspAI GCGC 1 cut(s) 132
Kzo9I GATC 1 cut(s) 90
LmnI GCTCC 2 cut(s) 58, 160
LpnPI CCDG 3 cut(s) 120, 155, 194
MaeI CTAG 1 cut(s) 147
MaeII ACGT 1 cut(s) 238
MalI GATC 1 cut(s) 92
MboI GATC 1 cut(s) 90
MboII GAAGA 1 cut(s) 100
MflI RGATCY 1 cut(s) 90
MhlI GDGCHC 1 cut(s) 63
MluCI AATT 2 cut(s) 5, 213
MnlI CCTC 4 cut(s) 61, 174, 187, 248
MseI TTAA 3 cut(s) 21, 32, 268
MwoI GCNNNNNNNGC 2 cut(s) 131, 176
NdeII GATC 1 cut(s) 90
NlaIII CATG 3 cut(s) 29, 170, 194
NlaIV GGNNCC 2 cut(s) 140, 162
NsbI TGCGCA 1 cut(s) 133
PfeI GAWTC 1 cut(s) 106
Psp124BI GAGCTC 1 cut(s) 63
PspN4I GGNNCC 2 cut(s) 140, 162
PsuI RGATCY 1 cut(s) 90
SacI GAGCTC 1 cut(s) 63
SaqAI TTAA 3 cut(s) 21, 32, 268
Sau3AI GATC 1 cut(s) 90
SduI GDGCHC 1 cut(s) 63
SetI ASST 4 cut(s) 42, 63, 223, 241
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 2 cut(s) 5, 213
SspMI CTAG 1 cut(s) 147
SstI GAGCTC 1 cut(s) 63
StyI CCWWGG 1 cut(s) 198
TaiI ACGT 1 cut(s) 241
TasI AATT 2 cut(s) 5, 213
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 3 cut(s) 21, 32, 268
Tru9I TTAA 3 cut(s) 21, 32, 268
TspDTI ATGAA 1 cut(s) 220
XspI CTAG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.