Rmu_sc0003122.1_g000004

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003122.1
Physical Location & Seq
Reverse (-)
9420 .. 10860
1441 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003122.1_g000004.1.cds

Sequence Viewer

Length: 534 bp
atggaattgaataacaaacttaaccatgagttaaacaagcttggaatagagataatggagctcagagaggagttgtctgacttggagaagatccacaagcaacagattcaagaaaatgagaacgcatattgcgcagggttcctgactagttggttcaaggagcctcatgccaacattgccctgccaagccatgaggccaaggacgttgctcttctagatcatgaacttctggaggccctatctccactctttcacacttctgccttaattaaactgaagtggagccctaaatccaaaaccagaaaattcttcaacatcaccttttcaccgttgcacctagcccgtgctagactagccgctgctgcccaccggcacacccctgctttgcacgctgcccctacagtccttaggcactcatgtgcagcctactgcccctgcatcatcgccgcacgcctgctgcccctgcagcacagcaggacgctcattcctgtgcagatcagccttgttaaattttttagctccactttggtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

177

Amino Acids

20.01

Weight (kDa)

8.95

Isoelectric Point (pI)

49.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 133
AciI CCGC 2 cut(s) 357, 447
AclWI GGATC 1 cut(s) 85
AcsI RAATTY 2 cut(s) 305, 509
AcuI CTGAAG 1 cut(s) 296
AgsI TTSAA 4 cut(s) 10, 110, 157, 313
AhlI ACTAGT 1 cut(s) 146
AleI CACNNNNGTG 1 cut(s) 417
AluBI AGCT 3 cut(s) 40, 61, 519
AluI AGCT 3 cut(s) 40, 61, 519
Alw21I GWGCWC 1 cut(s) 63
AlwI GGATC 1 cut(s) 85
AoxI GGCC 2 cut(s) 195, 234
ApeKI GCWGC 6 cut(s) 359, 362, 392, 422, 457, 466
ApoI RAATTY 2 cut(s) 305, 509
AspLEI GCGC 1 cut(s) 134
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 2 cut(s) 310, 318
AxyI CCTNAGG 1 cut(s) 407
BanII GRGCYC 2 cut(s) 63, 287
Bbv12I GWGCWC 1 cut(s) 63
BbvI GCAGC 6 cut(s) 346, 349, 379, 434, 444, 478
BcuI ACTAGT 1 cut(s) 146
BfaI CTAG 5 cut(s) 147, 215, 338, 348, 353
BfmI CTRYAG 2 cut(s) 399, 464
BisI GCNGC 8 cut(s) 357, 360, 363, 393, 423, 447, 458, 467
BlsI GCNGC 8 cut(s) 358, 361, 364, 394, 424, 448, 459, 468
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 3 cut(s) 140, 162, 284
BmsI GCATC 1 cut(s) 447
BpmI CTGGAG 1 cut(s) 251
BsaJI CCNNGG 1 cut(s) 198
Bse118I RCCGGY 1 cut(s) 369
Bse21I CCTNAGG 1 cut(s) 407
Bse3DI GCAATG 1 cut(s) 174
BseDI CCNNGG 1 cut(s) 198
BseMI GCAATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 76
BseRI GAGGAG 1 cut(s) 83
BseXI GCAGC 6 cut(s) 346, 349, 379, 434, 444, 478
BsgI GTGCAG 2 cut(s) 441, 512
BshFI GGCC 2 cut(s) 197, 236
BsiHKAI GWGCWC 1 cut(s) 63
BsiSI CCGG 1 cut(s) 370
BsnI GGCC 2 cut(s) 197, 236
Bsp1286I GDGCHC 2 cut(s) 63, 287
Bsp143I GATC 3 cut(s) 90, 217, 495
BspACI CCGC 2 cut(s) 357, 447
BspANI GGCC 2 cut(s) 197, 236
BspCNI CTCAG 1 cut(s) 75
BspHI TCATGA 1 cut(s) 220
BspLI GGNNCC 3 cut(s) 140, 162, 284
BspMAI CTGCAG 1 cut(s) 468
BspPI GGATC 1 cut(s) 85
BspQI GCTCTTC 1 cut(s) 216
BsrDI GCAATG 1 cut(s) 174
BsrFI RCCGGY 1 cut(s) 369
BssAI RCCGGY 1 cut(s) 369
BssECI CCNNGG 1 cut(s) 198
BssMI GATC 3 cut(s) 90, 217, 495
BssT1I CCWWGG 1 cut(s) 198
Bst4CI ACNGT 2 cut(s) 330, 403
Bst6I CTCTTC 1 cut(s) 216
BstC8I GCNNGC 3 cut(s) 390, 451, 455
BstDEI CTNAG 2 cut(s) 62, 407
BstHHI GCGC 1 cut(s) 134
BstKTI GATC 3 cut(s) 93, 220, 498
BstMBI GATC 3 cut(s) 90, 217, 495
BstMWI GCNNNNNNNGC 7 cut(s) 131, 176, 353, 362, 389, 463, 466
BstSFI CTRYAG 2 cut(s) 399, 464
BstV1I GCAGC 6 cut(s) 346, 349, 379, 434, 444, 478
BstX2I RGATCY 1 cut(s) 90
BstYI RGATCY 1 cut(s) 90
Bsu36I CCTNAGG 1 cut(s) 407
BsuRI GGCC 2 cut(s) 197, 236
BtgZI GCGATG 1 cut(s) 427
Cac8I GCNNGC 3 cut(s) 390, 451, 455
CciI TCATGA 1 cut(s) 220
CfoI GCGC 1 cut(s) 134
Cfr10I RCCGGY 1 cut(s) 369
Cfr13I GGNCC 1 cut(s) 235
CseI GACGC 1 cut(s) 487
CviAII CATG 5 cut(s) 26, 167, 191, 221, 417
DdeI CTNAG 2 cut(s) 62, 407
DpnI GATC 3 cut(s) 92, 219, 497
DpnII GATC 3 cut(s) 90, 217, 495
Eam1104I CTCTTC 1 cut(s) 216
EarI CTCTTC 1 cut(s) 216
Ecl136II GAGCTC 1 cut(s) 61
Eco130I CCWWGG 1 cut(s) 198
Eco24I GRGCYC 2 cut(s) 63, 287
Eco53kI GAGCTC 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 296
Eco81I CCTNAGG 1 cut(s) 407
EcoICRI GAGCTC 1 cut(s) 61
EcoO109I RGGNCCY 1 cut(s) 235
EcoT14I CCWWGG 1 cut(s) 198
EcoT38I GRGCYC 2 cut(s) 63, 287
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 5 cut(s) 29, 170, 194, 224, 420
FaiI YATR 6 cut(s) 27, 127, 168, 192, 222, 418
FatI CATG 5 cut(s) 25, 166, 190, 220, 416
Fnu4HI GCNGC 8 cut(s) 357, 360, 363, 393, 423, 447, 458, 467
FriOI GRGCYC 2 cut(s) 63, 287
Fsp4HI GCNGC 8 cut(s) 357, 360, 363, 393, 423, 447, 458, 467
FspBI CTAG 5 cut(s) 147, 215, 338, 348, 353
FspI TGCGCA 1 cut(s) 133
GlaI GCGC 1 cut(s) 133
GluI GCNGC 8 cut(s) 357, 360, 363, 393, 423, 447, 458, 467
GsuI CTGGAG 1 cut(s) 251
HaeIII GGCC 2 cut(s) 197, 236
HapII CCGG 1 cut(s) 370
HgaI GACGC 1 cut(s) 487
HhaI GCGC 1 cut(s) 134
Hin1II CATG 5 cut(s) 29, 170, 194, 224, 420
Hin6I GCGC 1 cut(s) 132
HinP1I GCGC 1 cut(s) 132
HindIII AAGCTT 1 cut(s) 38
HinfI GANTC 1 cut(s) 106
HpaII CCGG 1 cut(s) 370
HphI GGTGA 2 cut(s) 310, 318
Hpy188I TCNGA 2 cut(s) 65, 79
Hpy188III TCNNGA 5 cut(s) 110, 142, 215, 221, 230
HpyCH4III ACNGT 2 cut(s) 330, 403
HpyCH4IV ACGT 1 cut(s) 204
HpyCH4V TGCA 6 cut(s) 334, 388, 422, 438, 466, 493
HpyF10VI GCNNNNNNNGC 7 cut(s) 131, 176, 353, 362, 389, 463, 466
HpyF3I CTNAG 2 cut(s) 62, 407
HpySE526I ACGT 1 cut(s) 204
Hsp92II CATG 5 cut(s) 29, 170, 194, 224, 420
HspAI GCGC 1 cut(s) 132
Kzo9I GATC 3 cut(s) 90, 217, 495
LguI GCTCTTC 1 cut(s) 216
LmnI GCTCC 4 cut(s) 58, 160, 282, 524
Lsp1109I GCAGC 6 cut(s) 346, 349, 379, 434, 444, 478
LweI GCATC 1 cut(s) 447
MaeI CTAG 5 cut(s) 147, 215, 338, 348, 353
MaeII ACGT 1 cut(s) 204
MalI GATC 3 cut(s) 92, 219, 497
MboI GATC 3 cut(s) 90, 217, 495
MboII GAAGA 3 cut(s) 100, 203, 301
MflI RGATCY 1 cut(s) 90
MhlI GDGCHC 2 cut(s) 63, 287
MluCI AATT 4 cut(s) 5, 267, 305, 509
MnlI CCTC 4 cut(s) 61, 174, 187, 226
MseI TTAA 5 cut(s) 21, 32, 266, 270, 507
MslI CAYNNNNRTG 2 cut(s) 417, 488
MspA1I CMGCKG 1 cut(s) 359
MspI CCGG 1 cut(s) 370
MwoI GCNNNNNNNGC 7 cut(s) 131, 176, 353, 362, 389, 463, 466
NdeII GATC 3 cut(s) 90, 217, 495
NlaIII CATG 5 cut(s) 29, 170, 194, 224, 420
NlaIV GGNNCC 3 cut(s) 140, 162, 284
NsbI TGCGCA 1 cut(s) 133
OliI CACNNNNGTG 1 cut(s) 417
PacI TTAATTAA 1 cut(s) 270
PagI TCATGA 1 cut(s) 220
PciSI GCTCTTC 1 cut(s) 216
PfeI GAWTC 1 cut(s) 106
PkrI GCNGC 8 cut(s) 358, 361, 364, 394, 424, 448, 459, 468
Psp124BI GAGCTC 1 cut(s) 63
PspN4I GGNNCC 3 cut(s) 140, 162, 284
PspPI GGNCC 1 cut(s) 235
PstI CTGCAG 1 cut(s) 468
PsuI RGATCY 1 cut(s) 90
RseI CAYNNNNRTG 2 cut(s) 417, 488
SacI GAGCTC 1 cut(s) 63
SapI GCTCTTC 1 cut(s) 216
SaqAI TTAA 5 cut(s) 21, 32, 266, 270, 507
SatI GCNGC 8 cut(s) 357, 360, 363, 393, 423, 447, 458, 467
Sau3AI GATC 3 cut(s) 90, 217, 495
Sau96I GGNCC 1 cut(s) 235
SduI GDGCHC 2 cut(s) 63, 287
SetI ASST 6 cut(s) 42, 63, 207, 323, 339, 521
SfaNI GCATC 1 cut(s) 447
SfcI CTRYAG 2 cut(s) 399, 464
SmiMI CAYNNNNRTG 2 cut(s) 417, 488
SpeI ACTAGT 1 cut(s) 146
Sse9I AATT 4 cut(s) 5, 267, 305, 509
SsiI CCGC 2 cut(s) 357, 447
SspMI CTAG 5 cut(s) 147, 215, 338, 348, 353
SstI GAGCTC 1 cut(s) 63
StyI CCWWGG 1 cut(s) 198
TaaI ACNGT 2 cut(s) 330, 403
TaiI ACGT 1 cut(s) 207
TasI AATT 4 cut(s) 5, 267, 305, 509
TauI GCSGC 2 cut(s) 359, 449
TfiI GAWTC 1 cut(s) 106
Tru1I TTAA 5 cut(s) 21, 32, 266, 270, 507
Tru9I TTAA 5 cut(s) 21, 32, 266, 270, 507
TseI GCWGC 6 cut(s) 359, 362, 392, 422, 457, 466
TspDTI ATGAA 1 cut(s) 237
XapI RAATTY 2 cut(s) 305, 509
XbaI TCTAGA 1 cut(s) 214
XspI CTAG 5 cut(s) 147, 215, 338, 348, 353
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.