Rmu_sc0003417.1_g000021

Nudix hydrolase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003417.1
Physical Location & Seq
Forward (+)
92188 .. 94735
2548 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003417.1_g000021.1.cds

Sequence Viewer

Length: 882 bp
atgtcagtttcaacaagttcatgtgctgttgcaaagcaatgcttgatggccgaaagtggagttgagcagattgaattgctcaatgcacatgatgatatacatgggggagttgttgtagacatgaaagaccagcccatggattctgaggtctttggttctttgctcaaagcttcactgtcagaatggaggcaaaaggaaaagaagggtgtttggatcaaattgccgattgaactctcaaatcttgttcatgctgcagttcaggaaggatttacttatcaccatgctgaatcagattacctaatgcttaaacgttggctgcctgaaactgttgatactcttcctgcgaatgcctctcatcgagtgggcattggtgctttcatcatgaacaataagagagaggtgcttgtggttcaggagatcaatggcagattcaaagatacaggtgtctggaagatgcctactggggctgttaatgaaggagaggatatttgtgcagcagcagttagggaagtcaaagaagagacaggaattgaggcagagtttgtggaaatattagcgttcaggcaaagccacaagtcattctttcgaaaatcagatttatttttcgtttgcatgttaaaaccgcaaacctttgacatacaggagcagaatcaagagattgcagcagcccagtggatgccatttgaggactatgcagctcaaccctttgtcaaacaaaacaaactctttgattatgtagcagaaatatgtttggcaaaaacagatgagcattatactggttttactcctctagcaacgactacatcctccggaaaagcaagctacttgtatttcaaccaccgggatatgggtggcctactcacttccgataaacaacagtag

Protein Analysis

293

Amino Acids

32.95

Weight (kDa)

5.25

Isoelectric Point (pI)

52.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 136
AccI GTMKAC 1 cut(s) 117
AccIII TCCGGA 1 cut(s) 809
AciI CCGC 1 cut(s) 623
AclI AACGTT 1 cut(s) 310
AclWI GGATC 1 cut(s) 221
AcoI YGGCCR 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 136, 847
AgsI TTSAA 5 cut(s) 12, 74, 230, 433, 835
AluBI AGCT 3 cut(s) 170, 698, 822
AluI AGCT 3 cut(s) 170, 698, 822
Alw26I GTCTC 1 cut(s) 515
AlwI GGATC 1 cut(s) 221
Aor13HI TCCGGA 1 cut(s) 809
AoxI GGCC 2 cut(s) 48, 853
ApeKI GCWGC 7 cut(s) 251, 316, 494, 497, 662, 665, 695
AsuC2I CCSGG 1 cut(s) 842
AsuHPI GGTGA 1 cut(s) 269
AsuII TTCGAA 1 cut(s) 586
BaeI ACNNNNGTAYC 2 cut(s) 429, 462
BbvI GCAGC 7 cut(s) 238, 303, 506, 509, 674, 677, 707
BccI CCATC 1 cut(s) 40
BcnI CCSGG 1 cut(s) 842
BcoDI GTCTC 1 cut(s) 515
BfaI CTAG 1 cut(s) 791
BfmI CTRYAG 1 cut(s) 252
BisI GCNGC 7 cut(s) 252, 317, 495, 498, 663, 666, 696
BlsI GCNGC 7 cut(s) 253, 318, 496, 499, 664, 667, 697
Bme1390I CCNGG 1 cut(s) 842
BmrFI CCNGG 1 cut(s) 842
BmrI ACTGGG 2 cut(s) 471, 664
BmsI GCATC 2 cut(s) 444, 666
BmuI ACTGGG 2 cut(s) 471, 664
Bpu14I TTCGAA 1 cut(s) 586
BpuMI CCSGG 1 cut(s) 842
BsaJI CCNNGG 1 cut(s) 135
BsaWI WCCGGW 1 cut(s) 809
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bsc4I CCNNNNNNNGG 2 cut(s) 136, 847
Bse1I ACTGG 3 cut(s) 466, 670, 781
Bse3DI GCAATG 1 cut(s) 44
BseAI TCCGGA 1 cut(s) 809
BseDI CCNNGG 1 cut(s) 135
BseGI GGATG 2 cut(s) 681, 803
BseLI CCNNNNNNNGG 2 cut(s) 136, 847
BseMI GCAATG 1 cut(s) 44
BseMII CTCAG 1 cut(s) 135
BseNI ACTGG 3 cut(s) 466, 670, 781
BseRI GAGGAG 1 cut(s) 777
BseXI GCAGC 7 cut(s) 238, 303, 506, 509, 674, 677, 707
BsgI GTGCAG 1 cut(s) 513
BshFI GGCC 2 cut(s) 50, 855
BsiSI CCGG 2 cut(s) 810, 841
BslI CCNNNNNNNGG 2 cut(s) 136, 847
BsmAI GTCTC 1 cut(s) 515
BsmI GAATGC 1 cut(s) 352
BsnI GGCC 2 cut(s) 50, 855
Bsp119I TTCGAA 1 cut(s) 586
Bsp13I TCCGGA 1 cut(s) 809
Bsp143I GATC 2 cut(s) 213, 417
Bsp19I CCATGG 1 cut(s) 135
BspACI CCGC 1 cut(s) 623
BspANI GGCC 2 cut(s) 50, 855
BspCNI CTCAG 1 cut(s) 136
BspEI TCCGGA 1 cut(s) 809
BspHI TCATGA 1 cut(s) 381
BspMAI CTGCAG 1 cut(s) 256
BspPI GGATC 1 cut(s) 221
BspT104I TTCGAA 1 cut(s) 586
BsrDI GCAATG 1 cut(s) 44
BsrI ACTGG 3 cut(s) 466, 670, 781
BssECI CCNNGG 1 cut(s) 135
BssMI GATC 2 cut(s) 213, 417
BssT1I CCWWGG 1 cut(s) 135
Bst4CI ACNGT 3 cut(s) 177, 328, 879
Bst6I CTCTTC 2 cut(s) 342, 513
BstBI TTCGAA 1 cut(s) 586
BstC8I GCNNGC 1 cut(s) 820
BstDEI CTNAG 1 cut(s) 144
BstDSI CCRYGG 1 cut(s) 135
BstF5I GGATG 2 cut(s) 681, 803
BstKTI GATC 2 cut(s) 216, 420
BstMAI GTCTC 1 cut(s) 515
BstMBI GATC 2 cut(s) 213, 417
BstNSI RCATGY 1 cut(s) 616
BstSCI CCNGG 1 cut(s) 840
BstSFI CTRYAG 1 cut(s) 252
BstV1I GCAGC 7 cut(s) 238, 303, 506, 509, 674, 677, 707
BsuRI GGCC 2 cut(s) 50, 855
BtgI CCRYGG 1 cut(s) 135
BtsCI GGATG 2 cut(s) 681, 803
BtsIMutI CAGTG 2 cut(s) 173, 677
Cac8I GCNNGC 1 cut(s) 820
CciI TCATGA 1 cut(s) 381
CviAII CATG 9 cut(s) 21, 89, 101, 121, 136, 248, 281, 382, 613
DdeI CTNAG 1 cut(s) 144
DpnI GATC 2 cut(s) 215, 419
DpnII GATC 2 cut(s) 213, 417
EaeI YGGCCR 1 cut(s) 48
Eam1104I CTCTTC 2 cut(s) 342, 513
EarI CTCTTC 2 cut(s) 342, 513
Eco130I CCWWGG 1 cut(s) 135
EcoT14I CCWWGG 1 cut(s) 135
ErhI CCWWGG 1 cut(s) 135
FaeI CATG 9 cut(s) 24, 92, 104, 124, 139, 251, 284, 385, 616
FalI AAGNNNNNCTT 4 cut(s) 26, 58, 566, 598
FatI CATG 9 cut(s) 20, 88, 100, 120, 135, 247, 280, 381, 612
FblI GTMKAC 1 cut(s) 117
Fnu4HI GCNGC 7 cut(s) 252, 317, 495, 498, 663, 666, 696
FokI GGATG 2 cut(s) 688, 790
Fsp4HI GCNGC 7 cut(s) 252, 317, 495, 498, 663, 666, 696
FspBI CTAG 1 cut(s) 791
GluI GCNGC 7 cut(s) 252, 317, 495, 498, 663, 666, 696
HaeIII GGCC 2 cut(s) 50, 855
HapII CCGG 2 cut(s) 810, 841
Hin1II CATG 9 cut(s) 24, 92, 104, 124, 139, 251, 284, 385, 616
HindIII AAGCTT 1 cut(s) 168
HinfI GANTC 4 cut(s) 140, 287, 429, 649
HpaII CCGG 2 cut(s) 810, 841
HphI GGTGA 1 cut(s) 269
Hpy166II GTNNAC 1 cut(s) 118
Hpy188I TCNGA 5 cut(s) 145, 181, 292, 595, 868
Hpy188III TCNNGA 6 cut(s) 260, 382, 413, 448, 653, 810
Hpy8I GTNNAC 1 cut(s) 118
HpyAV CCTTC 3 cut(s) 196, 257, 470
HpyCH4III ACNGT 3 cut(s) 177, 328, 879
HpyCH4IV ACGT 1 cut(s) 310
HpyCH4V TGCA 7 cut(s) 32, 86, 254, 494, 612, 662, 695
HpyF3I CTNAG 1 cut(s) 144
HpySE526I ACGT 1 cut(s) 310
Hsp92II CATG 9 cut(s) 24, 92, 104, 124, 139, 251, 284, 385, 616
Kpn2I TCCGGA 1 cut(s) 809
Kzo9I GATC 2 cut(s) 213, 417
LmnI GCTCC 1 cut(s) 643
Lsp1109I GCAGC 7 cut(s) 238, 303, 506, 509, 674, 677, 707
LweI GCATC 2 cut(s) 444, 666
MaeI CTAG 1 cut(s) 791
MaeII ACGT 1 cut(s) 310
MalI GATC 2 cut(s) 215, 419
MboI GATC 2 cut(s) 213, 417
MboII GAAGA 3 cut(s) 329, 463, 530
MluCI AATT 3 cut(s) 74, 218, 528
MnlI CCTC 9 cut(s) 139, 180, 361, 391, 475, 526, 679, 798, 817
MroI TCCGGA 1 cut(s) 809
MseI TTAA 3 cut(s) 306, 471, 617
MspI CCGG 2 cut(s) 810, 841
MspR9I CCNGG 1 cut(s) 842
Mva1269I GAATGC 1 cut(s) 352
NciI CCSGG 1 cut(s) 842
NcoI CCATGG 1 cut(s) 135
NdeII GATC 2 cut(s) 213, 417
NlaIII CATG 9 cut(s) 24, 92, 104, 124, 139, 251, 284, 385, 616
NspI RCATGY 1 cut(s) 616
NspV TTCGAA 1 cut(s) 586
PagI TCATGA 1 cut(s) 381
PctI GAATGC 1 cut(s) 352
PfeI GAWTC 4 cut(s) 140, 287, 429, 649
PflMI CCANNNNNTGG 1 cut(s) 136
PkrI GCNGC 7 cut(s) 253, 318, 496, 499, 664, 667, 697
Psp1406I AACGTT 1 cut(s) 310
PstI CTGCAG 1 cut(s) 256
SaqAI TTAA 3 cut(s) 306, 471, 617
SatI GCNGC 7 cut(s) 252, 317, 495, 498, 663, 666, 696
Sau3AI GATC 2 cut(s) 213, 417
ScrFI CCNGG 1 cut(s) 842
SetI ASST 9 cut(s) 150, 172, 300, 313, 402, 445, 632, 700, 824
SfaNI GCATC 2 cut(s) 444, 666
SfcI CTRYAG 1 cut(s) 252
SfuI TTCGAA 1 cut(s) 586
Sse9I AATT 3 cut(s) 74, 218, 528
SsiI CCGC 1 cut(s) 623
SspI AATATT 1 cut(s) 552
SspMI CTAG 1 cut(s) 791
StyD4I CCNGG 1 cut(s) 840
StyI CCWWGG 1 cut(s) 135
TaaI ACNGT 3 cut(s) 177, 328, 879
TaiI ACGT 1 cut(s) 313
TaqI TCGA 2 cut(s) 358, 586
TasI AATT 3 cut(s) 74, 218, 528
TfiI GAWTC 4 cut(s) 140, 287, 429, 649
Tru1I TTAA 3 cut(s) 306, 471, 617
Tru9I TTAA 3 cut(s) 306, 471, 617
TscAI CASTG 2 cut(s) 180, 677
TseI GCWGC 7 cut(s) 251, 316, 494, 497, 662, 665, 695
TspDTI ATGAA 6 cut(s) 9, 137, 236, 367, 398, 489
TspRI CASTG 2 cut(s) 180, 677
Van91I CCANNNNNTGG 1 cut(s) 136
XceI RCATGY 1 cut(s) 616
XmiI GTMKAC 1 cut(s) 117
XspI CTAG 1 cut(s) 791
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.