Rmu_sc0003633.1_g000014

Caffeoylshikimate esterase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003633.1
OG0001162
Physical Location & Seq
Forward (+)
57792 .. 58629
838 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003633.1_g000014.1.cds

Sequence Viewer

Length: 567 bp
atggaaggaattcaaggggtatggaaattttctgcaaaagctggttgccaaaaccaggtgatcaaatcaaagcggaattctgcaaaagttggttgcgaaaaccaggtgatcaaatccaagctggcttatgtttctgccatgggtattgctaggagaattactcagtctgggtacgctgtgtatgcagtagactatccaggttttggtctttctgaagggttgcatggtttcatcccagactttgatgagttggtcgatgatgcagaggagtggtatggaaggaattcaaggggtatggaaattttctgcaaaagctggttgccaaaaccaggtgatcaaatcaaagctggcttatgtttttgccatgggtatggtagtacttgcacattcttctttgaaggtattgctaggagaattactcagtctgggtacgctgtgtatgcagtagactatccaggttttggtctttctgaagggttgcatggtttcatcccagactttgatgagttggtcgatgatgttattgaacaatttactagtatcaaaggtgtgaaattgattggttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00561 ko01100 ko04714 ko04723 ko04923 map00561 map01100 map04714 map04723 map04923
Pfam Domains
Protein Families
Hydrolase_4

Protein Analysis

188

Amino Acids

20.7

Weight (kDa)

5.63

Isoelectric Point (pI)

26.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 203, 461
AccI GTMKAC 2 cut(s) 189, 447
AciI CCGC 1 cut(s) 73
AcsI RAATTY 5 cut(s) 9, 26, 76, 283, 300
AcuI CTGAAG 2 cut(s) 234, 492
AfaI GTAC 3 cut(s) 173, 379, 431
AfiI CCNNNNNNNGG 4 cut(s) 55, 203, 329, 461
AgsI TTSAA 4 cut(s) 14, 288, 398, 527
AhlI ACTAGT 1 cut(s) 536
AjnI CCWGG 5 cut(s) 54, 102, 196, 328, 454
AluBI AGCT 4 cut(s) 41, 121, 315, 347
AluI AGCT 4 cut(s) 41, 121, 315, 347
ApoI RAATTY 5 cut(s) 9, 26, 76, 283, 300
Asp700I GAANNNNTTC 2 cut(s) 9, 283
AsuHPI GGTGA 3 cut(s) 70, 118, 344
BciT130I CCWGG 5 cut(s) 56, 104, 198, 330, 456
BclI TGATCA 3 cut(s) 60, 108, 334
BcuI ACTAGT 1 cut(s) 536
BfaI CTAG 3 cut(s) 150, 408, 537
BmcAI AGTACT 1 cut(s) 379
Bme1390I CCNGG 5 cut(s) 56, 104, 198, 330, 456
BmrFI CCNGG 5 cut(s) 56, 104, 198, 330, 456
BmsI GCATC 1 cut(s) 250
BplI GAGNNNNNCTC 4 cut(s) 145, 177, 403, 435
BsaJI CCNNGG 2 cut(s) 138, 364
Bsc4I CCNNNNNNNGG 4 cut(s) 55, 203, 329, 461
BseBI CCWGG 5 cut(s) 56, 104, 198, 330, 456
BseDI CCNNGG 2 cut(s) 138, 364
BseGI GGATG 2 cut(s) 231, 489
BseLI CCNNNNNNNGG 4 cut(s) 55, 203, 329, 461
BseMII CTCAG 2 cut(s) 176, 434
BseRI GAGGAG 1 cut(s) 281
BslI CCNNNNNNNGG 4 cut(s) 55, 203, 329, 461
Bsp143I GATC 3 cut(s) 60, 108, 334
Bsp19I CCATGG 2 cut(s) 138, 364
BspACI CCGC 1 cut(s) 73
BspCNI CTCAG 2 cut(s) 175, 433
BssECI CCNNGG 2 cut(s) 138, 364
BssMI GATC 3 cut(s) 60, 108, 334
BssT1I CCWWGG 2 cut(s) 138, 364
Bst2UI CCWGG 5 cut(s) 56, 104, 198, 330, 456
BstC8I GCNNGC 2 cut(s) 123, 349
BstDEI CTNAG 2 cut(s) 162, 420
BstDSI CCRYGG 2 cut(s) 138, 364
BstF5I GGATG 2 cut(s) 231, 489
BstKTI GATC 3 cut(s) 63, 111, 337
BstMBI GATC 3 cut(s) 60, 108, 334
BstMWI GCNNNNNNNGC 2 cut(s) 182, 440
BstNI CCWGG 5 cut(s) 56, 104, 198, 330, 456
BstSCI CCNGG 5 cut(s) 54, 102, 196, 328, 454
BstXI CCANNNNNNTGG 1 cut(s) 371
BtgI CCRYGG 2 cut(s) 138, 364
BtsCI GGATG 2 cut(s) 231, 489
Cac8I GCNNGC 2 cut(s) 123, 349
CsiI ACCWGGT 3 cut(s) 54, 102, 328
Csp6I GTAC 3 cut(s) 172, 378, 430
CviAII CATG 4 cut(s) 139, 224, 365, 482
CviJI RGCY 6 cut(s) 41, 121, 125, 315, 347, 351
CviKI_1 RGCY 6 cut(s) 41, 121, 125, 315, 347, 351
CviQI GTAC 3 cut(s) 172, 378, 430
DdeI CTNAG 2 cut(s) 162, 420
DpnI GATC 3 cut(s) 62, 110, 336
DpnII GATC 3 cut(s) 60, 108, 334
Eco130I CCWWGG 2 cut(s) 138, 364
Eco57I CTGAAG 2 cut(s) 234, 492
EcoRI GAATTC 3 cut(s) 9, 76, 283
EcoRII CCWGG 5 cut(s) 54, 102, 196, 328, 454
EcoT14I CCWWGG 2 cut(s) 138, 364
ErhI CCWWGG 2 cut(s) 138, 364
FaeI CATG 4 cut(s) 142, 227, 368, 485
FatI CATG 4 cut(s) 138, 223, 364, 481
FbaI TGATCA 3 cut(s) 60, 108, 334
FblI GTMKAC 2 cut(s) 189, 447
FokI GGATG 2 cut(s) 218, 476
FspBI CTAG 3 cut(s) 150, 408, 537
Hin1II CATG 4 cut(s) 142, 227, 368, 485
HphI GGTGA 3 cut(s) 70, 118, 344
Hpy166II GTNNAC 2 cut(s) 190, 448
Hpy188I TCNGA 2 cut(s) 214, 472
Hpy8I GTNNAC 2 cut(s) 190, 448
HpyAV CCTTC 4 cut(s) 209, 273, 392, 467
HpyCH4V TGCA 9 cut(s) 35, 83, 185, 223, 263, 309, 384, 443, 481
HpyF10VI GCNNNNNNNGC 2 cut(s) 182, 440
HpyF3I CTNAG 2 cut(s) 162, 420
Hsp92II CATG 4 cut(s) 142, 227, 368, 485
Ksp22I TGATCA 3 cut(s) 60, 108, 334
Kzo9I GATC 3 cut(s) 60, 108, 334
LweI GCATC 1 cut(s) 250
MabI ACCWGGT 3 cut(s) 54, 102, 328
MaeI CTAG 3 cut(s) 150, 408, 537
MalI GATC 3 cut(s) 62, 110, 336
MboI GATC 3 cut(s) 60, 108, 334
MboII GAAGA 1 cut(s) 382
MluCI AATT 9 cut(s) 9, 26, 76, 156, 283, 300, 414, 530, 554
MnlI CCTC 1 cut(s) 259
MroXI GAANNNNTTC 2 cut(s) 9, 283
MslI CAYNNNNRTG 1 cut(s) 369
MspR9I CCNGG 5 cut(s) 56, 104, 198, 330, 456
MvaI CCWGG 5 cut(s) 56, 104, 198, 330, 456
MwoI GCNNNNNNNGC 2 cut(s) 182, 440
NcoI CCATGG 2 cut(s) 138, 364
NdeII GATC 3 cut(s) 60, 108, 334
NlaIII CATG 4 cut(s) 142, 227, 368, 485
PdmI GAANNNNTTC 2 cut(s) 9, 283
PflMI CCANNNNNTGG 2 cut(s) 203, 461
Psp6I CCWGG 5 cut(s) 54, 102, 196, 328, 454
PspGI CCWGG 5 cut(s) 54, 102, 196, 328, 454
RsaI GTAC 3 cut(s) 173, 379, 431
RsaNI GTAC 3 cut(s) 172, 378, 430
RseI CAYNNNNRTG 1 cut(s) 369
Sau3AI GATC 3 cut(s) 60, 108, 334
ScaI AGTACT 1 cut(s) 379
ScrFI CCNGG 5 cut(s) 56, 104, 198, 330, 456
SexAI ACCWGGT 3 cut(s) 54, 102, 328
SfaNI GCATC 1 cut(s) 250
SmiMI CAYNNNNRTG 1 cut(s) 369
SpeI ACTAGT 1 cut(s) 536
Sse9I AATT 9 cut(s) 9, 26, 76, 156, 283, 300, 414, 530, 554
SsiI CCGC 1 cut(s) 73
SspMI CTAG 3 cut(s) 150, 408, 537
StyD4I CCNGG 5 cut(s) 54, 102, 196, 328, 454
StyI CCWWGG 2 cut(s) 138, 364
TaqI TCGA 2 cut(s) 255, 513
TasI AATT 9 cut(s) 9, 26, 76, 156, 283, 300, 414, 530, 554
TatI WGTACW 1 cut(s) 377
TspDTI ATGAA 2 cut(s) 220, 478
Van91I CCANNNNNTGG 2 cut(s) 203, 461
XapI RAATTY 5 cut(s) 9, 26, 76, 283, 300
XmiI GTMKAC 2 cut(s) 189, 447
XmnI GAANNNNTTC 2 cut(s) 9, 283
XspI CTAG 3 cut(s) 150, 408, 537
ZrmI AGTACT 1 cut(s) 379
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.