Rh6AG077600

Caffeoylshikimate esterase-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
Physical Location & Seq
Forward (+)
11264271 .. 11264623
353 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG077600.1

Sequence Viewer

Length: 273 bp
ATGGAAATTTTCTGCAAAAGCTGGTTGCCAAAACCAGGTGATCAAATCAAAGCTGGCTTATGTTTCTGCCATGGGTACGGTAGTACTTGCACATTCTTCTTTGAAGGTATTGCTAGGAGAATTGCTCAGTCTGGGTACGCTGTGTATGCAGTAGACTATCCAGGTTTTGGCCTTTCTGAAGGGTTGCATGGTTTCATCCCAGACTTTGATGAGTTGGTCGATGATGTTATTGAACAATTTACTAGTATCAAAGGTGTGAAATTGATTGGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

90

Amino Acids

9.92

Weight (kDa)

4.88

Isoelectric Point (pI)

34.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Hydrolase_4 PF12146 15 - 84 2.9e-17 Serine aminopeptidase, S33
Abhydrolase_1 PF00561 20 - 76 8e-06 alpha/beta hydrolase fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 167
AccI GTMKAC 1 cut(s) 153
AcsI RAATTY 1 cut(s) 6
AcuI CTGAAG 1 cut(s) 198
AfaI GTAC 3 cut(s) 77, 85, 137
AfiI CCNNNNNNNGG 2 cut(s) 35, 167
AgsI TTSAA 2 cut(s) 104, 233
AhlI ACTAGT 1 cut(s) 242
AjnI CCWGG 2 cut(s) 34, 160
AluBI AGCT 2 cut(s) 21, 53
AluI AGCT 2 cut(s) 21, 53
AoxI GGCC 1 cut(s) 169
ApoI RAATTY 1 cut(s) 6
AsuHPI GGTGA 1 cut(s) 50
BaeI ACNNNNGTAYC 2 cut(s) 67, 100
BciT130I CCWGG 2 cut(s) 36, 162
BclI TGATCA 1 cut(s) 40
BcuI ACTAGT 1 cut(s) 242
BfaI CTAG 2 cut(s) 114, 243
BmcAI AGTACT 1 cut(s) 85
Bme1390I CCNGG 2 cut(s) 36, 162
BmrFI CCNGG 2 cut(s) 36, 162
BplI GAGNNNNNCTC 2 cut(s) 109, 141
BsaJI CCNNGG 1 cut(s) 70
Bsc4I CCNNNNNNNGG 2 cut(s) 35, 167
BseBI CCWGG 2 cut(s) 36, 162
BseDI CCNNGG 1 cut(s) 70
BseGI GGATG 1 cut(s) 195
BseLI CCNNNNNNNGG 2 cut(s) 35, 167
BseMII CTCAG 1 cut(s) 140
BshFI GGCC 1 cut(s) 171
BslI CCNNNNNNNGG 2 cut(s) 35, 167
BsnI GGCC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 40
Bsp19I CCATGG 1 cut(s) 70
BspANI GGCC 1 cut(s) 171
BspCNI CTCAG 1 cut(s) 139
BssECI CCNNGG 1 cut(s) 70
BssMI GATC 1 cut(s) 40
BssT1I CCWWGG 1 cut(s) 70
Bst2UI CCWGG 2 cut(s) 36, 162
Bst4CI ACNGT 1 cut(s) 80
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 126
BstDSI CCRYGG 1 cut(s) 70
BstF5I GGATG 1 cut(s) 195
BstKTI GATC 1 cut(s) 43
BstMBI GATC 1 cut(s) 40
BstMWI GCNNNNNNNGC 1 cut(s) 146
BstNI CCWGG 2 cut(s) 36, 162
BstSCI CCNGG 2 cut(s) 34, 160
BsuRI GGCC 1 cut(s) 171
BtgI CCRYGG 1 cut(s) 70
BtsCI GGATG 1 cut(s) 195
Cac8I GCNNGC 1 cut(s) 55
CsiI ACCWGGT 1 cut(s) 34
Csp6I GTAC 3 cut(s) 76, 84, 136
CviAII CATG 2 cut(s) 71, 188
CviJI RGCY 4 cut(s) 21, 53, 57, 171
CviKI_1 RGCY 4 cut(s) 21, 53, 57, 171
CviQI GTAC 3 cut(s) 76, 84, 136
DdeI CTNAG 1 cut(s) 126
DpnI GATC 1 cut(s) 42
DpnII GATC 1 cut(s) 40
Eco130I CCWWGG 1 cut(s) 70
Eco57I CTGAAG 1 cut(s) 198
EcoRII CCWGG 2 cut(s) 34, 160
EcoT14I CCWWGG 1 cut(s) 70
ErhI CCWWGG 1 cut(s) 70
FaeI CATG 2 cut(s) 74, 191
FaiI YATR 4 cut(s) 61, 72, 147, 189
FatI CATG 2 cut(s) 70, 187
FbaI TGATCA 1 cut(s) 40
FblI GTMKAC 1 cut(s) 153
FokI GGATG 1 cut(s) 182
FspBI CTAG 2 cut(s) 114, 243
HaeIII GGCC 1 cut(s) 171
Hin1II CATG 2 cut(s) 74, 191
HphI GGTGA 1 cut(s) 50
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 1 cut(s) 178
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 98, 173
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 4 cut(s) 15, 90, 149, 187
HpyF10VI GCNNNNNNNGC 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 126
Hsp92II CATG 2 cut(s) 74, 191
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 1 cut(s) 40
LpnPI CCDG 8 cut(s) 7, 21, 39, 48, 117, 147, 174, 213
MabI ACCWGGT 1 cut(s) 34
MaeI CTAG 2 cut(s) 114, 243
MalI GATC 1 cut(s) 42
MboI GATC 1 cut(s) 40
MboII GAAGA 1 cut(s) 88
MluCI AATT 4 cut(s) 6, 120, 236, 260
MspR9I CCNGG 2 cut(s) 36, 162
MvaI CCWGG 2 cut(s) 36, 162
MwoI GCNNNNNNNGC 1 cut(s) 146
NcoI CCATGG 1 cut(s) 70
NdeII GATC 1 cut(s) 40
NlaIII CATG 2 cut(s) 74, 191
PflMI CCANNNNNTGG 1 cut(s) 167
Psp6I CCWGG 2 cut(s) 34, 160
PspGI CCWGG 2 cut(s) 34, 160
RsaI GTAC 3 cut(s) 77, 85, 137
RsaNI GTAC 3 cut(s) 76, 84, 136
Sau3AI GATC 1 cut(s) 40
ScaI AGTACT 1 cut(s) 85
ScrFI CCNGG 2 cut(s) 36, 162
SetI ASST 6 cut(s) 23, 40, 55, 109, 166, 256
SexAI ACCWGGT 1 cut(s) 34
SpeI ACTAGT 1 cut(s) 242
Sse9I AATT 4 cut(s) 6, 120, 236, 260
SspMI CTAG 2 cut(s) 114, 243
StyD4I CCNGG 2 cut(s) 34, 160
StyI CCWWGG 1 cut(s) 70
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 219
TasI AATT 4 cut(s) 6, 120, 236, 260
TatI WGTACW 1 cut(s) 83
TspDTI ATGAA 1 cut(s) 184
Van91I CCANNNNNTGG 1 cut(s) 167
XapI RAATTY 1 cut(s) 6
XmiI GTMKAC 1 cut(s) 153
XspI CTAG 2 cut(s) 114, 243
ZrmI AGTACT 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.