Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0005139.1

Orthogroup ID

OG0004243

Physical Location & Seq

Genomic Coordinates Forward (+)

48953 .. 50625

Gene Structure 1673 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0005139.1_g000014.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 666 bp

atgaatgcctataaataccctcctctaccaaatcctccaaaatacggagacgtctggaattccaagacgatggaaaagagcgagagcgataacagcatgggcgaaaattcgcaggagatttacgaatctaaaactgtgttattcaagaagcagggtctctgcaaagaagagaatctgaaccaagtctggaagaaagaggtggaagcagtctttgaatctcatggcctttcatgcgaattgaactgtgatgagtgtaagatgactgtcactgcaacagaacgtaccgaaggtggtcttcttcaagatggctttgataggggttttaatgctctctttgttctcgcatgtggtctcggcactgaatgggttgaaccaatcgtctccggcagtgtctatagtgaggtcatgtatattagaataccagatggcatgagtcaggatgatttttcaagcaagtatcaagatttcatatacaaatttgaacacaaatttggactacctcgaaagctgtcctgctttgttctttatcttgaagcatctgttgtcgtcctttccgataaagccgggtcaacaagtacagtgaggaaccttgtgcttagttgtctaaatgacgatgatccttttgatgaagaccattttcatgaattgttccttgatgatctttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

221

Amino Acids

25.1

Weight (kDa)

4.57

Isoelectric Point (pI)

43.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004243)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g04690
rosa_chinensis	RchiOBHm_Chr1g0384141
rosa_laevigata	RLG00000026068
rosa_multiflora	Rmu_sc0005139.1_g000009 Rmu_sc0005139.1_g000011 Rmu_sc0005139.1_g000012 Rmu_sc0005139.1_g000014 Rmu_sc0005139.1_g000015 Rmu_sc0014419.1_g000002 Rmu_sc0014419.1_g000005
rosa_roxburghii	Rroxscaffold_4G00276890 Rroxscaffold_4G00276900 Rroxscaffold_4G00276920 Rroxscaffold_4G00276950 Rroxscaffold_6G00397390
rosa_rugosa	Rorug01G0445100 Rorug01G0445200 Rorug01G0445200 Rorug01G0445300
rosa_samantha	Rh1AG470700 Rh1AG470800 Rh1BG428100 Rh1BG428200 Rh1BG428300 Rh1BG428400 Rh1CG440800 Rh1CG441000 Rh1CG441100 Rh1DG461100 Rh1DG461200
rosa_wichuraiana	Rw1G040180 Rw1G040190 Rw1G040200

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AatII	GACGTC	1 cut(s)	54
AclWI	GGATC	1 cut(s)	611
AcsI	RAATTY	4 cut(s)	58, 106, 476, 488
AcyI	GRCGYC	1 cut(s)	51
AfaI	GTAC	2 cut(s)	283, 577
AfiI	CCNNNNNNNGG	1 cut(s)	44
AgsI	TTSAA	8 cut(s)	145, 215, 241, 302, 371, 450, 482, 533
AjuI	GAANNNNNNNTTGG	2 cut(s)	474, 506
AluBI	AGCT	1 cut(s)	508
AluI	AGCT	1 cut(s)	508
Alw26I	GTCTC	4 cut(s)	42, 161, 356, 385
AlwI	GGATC	1 cut(s)	611
AoxI	GGCC	1 cut(s)	223
ApoI	RAATTY	4 cut(s)	58, 106, 476, 488
AsuC2I	CCSGG	1 cut(s)	565
BbsI	GAAGAC	2 cut(s)	287, 636
BccI	CCATC	3 cut(s)	64, 299, 419
BcnI	CCSGG	1 cut(s)	565
BcoDI	GTCTC	4 cut(s)	42, 161, 356, 385
BfmI	CTRYAG	1 cut(s)	394
Bme1390I	CCNGG	1 cut(s)	565
BmiI	GGNNCC	1 cut(s)	587
BmrFI	CCNGG	1 cut(s)	565
BmsI	GCATC	1 cut(s)	545
BpiI	GAAGAC	2 cut(s)	287, 636
BpuMI	CCSGG	1 cut(s)	565
BsaHI	GRCGYC	1 cut(s)	51
BsaI	GGTCTC	2 cut(s)	161, 356
Bsc4I	CCNNNNNNNGG	1 cut(s)	44
BseGI	GGATG	1 cut(s)	445
BseLI	CCNNNNNNNGG	1 cut(s)	44
BseRI	GAGGAG	1 cut(s)	12
BshFI	GGCC	1 cut(s)	225
BsiSI	CCGG	2 cut(s)	384, 564
BslI	CCNNNNNNNGG	1 cut(s)	44
BsmAI	GTCTC	4 cut(s)	42, 161, 356, 385
BsmBI	CGTCTC	2 cut(s)	42, 385
BsmI	GAATGC	1 cut(s)	10
BsnI	GGCC	1 cut(s)	225
Bso31I	GGTCTC	2 cut(s)	161, 356
Bsp143I	GATC	2 cut(s)	616, 658
BspANI	GGCC	1 cut(s)	225
BspHI	TCATGA	1 cut(s)	640
BspLI	GGNNCC	1 cut(s)	587
BspPI	GGATC	1 cut(s)	611
BspTNI	GGTCTC	2 cut(s)	161, 356
BssMI	GATC	2 cut(s)	616, 658
BssNI	GRCGYC	1 cut(s)	51
Bst4CI	ACNGT	4 cut(s)	136, 245, 265, 580
Bst6I	CTCTTC	1 cut(s)	162
BstACI	GRCGYC	1 cut(s)	51
BstDEI	CTNAG	1 cut(s)	596
BstF5I	GGATG	1 cut(s)	445
BstKTI	GATC	2 cut(s)	619, 661
BstMAI	GTCTC	4 cut(s)	42, 161, 356, 385
BstMBI	GATC	2 cut(s)	616, 658
BstMWI	GCNNNNNNNGC	2 cut(s)	93, 231
BstNSI	RCATGY	1 cut(s)	348
BstSCI	CCNGG	1 cut(s)	563
BstSFI	CTRYAG	1 cut(s)	394
BstV2I	GAAGAC	2 cut(s)	287, 636
BstXI	CCANNNNNNTGG	1 cut(s)	70
BsuRI	GGCC	1 cut(s)	225
BtsCI	GGATG	1 cut(s)	445
BtsI	GCAGTG	2 cut(s)	267, 394
BtsIMutI	CAGTG	4 cut(s)	267, 357, 394, 585
CciI	TCATGA	1 cut(s)	640
Csp6I	GTAC	2 cut(s)	282, 576
CviAII	CATG	7 cut(s)	97, 221, 231, 345, 406, 430, 641
CviJI	RGCY	4 cut(s)	225, 309, 508, 563
CviKI_1	RGCY	4 cut(s)	225, 309, 508, 563
CviQI	GTAC	2 cut(s)	282, 576
DdeI	CTNAG	1 cut(s)	596
DpnI	GATC	2 cut(s)	618, 660
DpnII	GATC	2 cut(s)	616, 658
Eam1104I	CTCTTC	1 cut(s)	162
EarI	CTCTTC	1 cut(s)	162
Eco31I	GGTCTC	2 cut(s)	161, 356
EcoRI	GAATTC	1 cut(s)	58
Esp3I	CGTCTC	2 cut(s)	42, 385
FaeI	CATG	7 cut(s)	100, 224, 234, 348, 409, 433, 644
FalI	AAGNNNNNCTT	2 cut(s)	279, 311
FatI	CATG	7 cut(s)	96, 220, 230, 344, 405, 429, 640
FokI	GGATG	1 cut(s)	452
HaeIII	GGCC	1 cut(s)	225
HapII	CCGG	2 cut(s)	384, 564
Hin1I	GRCGYC	1 cut(s)	51
Hin1II	CATG	7 cut(s)	100, 224, 234, 348, 409, 433, 644
HincII	GTYRAC	1 cut(s)	570
HindII	GTYRAC	1 cut(s)	570
HinfI	GANTC	4 cut(s)	125, 172, 215, 433
HpaII	CCGG	2 cut(s)	384, 564
Hpy166II	GTNNAC	1 cut(s)	570
Hpy188I	TCNGA	2 cut(s)	177, 556
Hpy188III	TCNNGA	8 cut(s)	55, 145, 187, 302, 437, 461, 530, 641
Hpy8I	GTNNAC	1 cut(s)	570
HpyAV	CCTTC	1 cut(s)	281
HpyCH4III	ACNGT	4 cut(s)	136, 245, 265, 580
HpyCH4IV	ACGT	2 cut(s)	51, 280
HpyCH4V	TGCA	2 cut(s)	162, 272
HpyF10VI	GCNNNNNNNGC	2 cut(s)	93, 231
HpyF3I	CTNAG	1 cut(s)	596
HpySE526I	ACGT	2 cut(s)	51, 280
Hsp92I	GRCGYC	1 cut(s)	51
Hsp92II	CATG	7 cut(s)	100, 224, 234, 348, 409, 433, 644
Kzo9I	GATC	2 cut(s)	616, 658
LpnPI	CCDG	9 cut(s)	40, 98, 137, 172, 397, 422, 435, 526, 577
LweI	GCATC	1 cut(s)	545
MaeII	ACGT	2 cut(s)	51, 280
MaeIII	GTNAC	1 cut(s)	265
MalI	GATC	2 cut(s)	618, 660
MboI	GATC	2 cut(s)	616, 658
MboII	GAAGA	5 cut(s)	179, 202, 287, 290, 641
MluCI	AATT	6 cut(s)	58, 106, 236, 476, 488, 644
MlyI	GAGTC	1 cut(s)	442
MnlI	CCTC	7 cut(s)	30, 33, 45, 190, 394, 510, 576
MseI	TTAA	2 cut(s)	324, 664
MslI	CAYNNNNRTG	1 cut(s)	639
MspI	CCGG	2 cut(s)	384, 564
MspR9I	CCNGG	1 cut(s)	565
Mva1269I	GAATGC	1 cut(s)	10
MwoI	GCNNNNNNNGC	2 cut(s)	93, 231
NciI	CCSGG	1 cut(s)	565
NdeII	GATC	2 cut(s)	616, 658
NlaIII	CATG	7 cut(s)	100, 224, 234, 348, 409, 433, 644
NlaIV	GGNNCC	1 cut(s)	587
NmeAIII	GCCGAG	1 cut(s)	333
NmuCI	GTSAC	1 cut(s)	265
NspI	RCATGY	1 cut(s)	348
PagI	TCATGA	1 cut(s)	640
PcsI	WCGNNNNNNNCGW	1 cut(s)	552
PctI	GAATGC	1 cut(s)	10
PfeI	GAWTC	3 cut(s)	125, 172, 215
PleI	GAGTC	1 cut(s)	441
PpsI	GAGTC	1 cut(s)	441
PspN4I	GGNNCC	1 cut(s)	587
RsaI	GTAC	2 cut(s)	283, 577
RsaNI	GTAC	2 cut(s)	282, 576
RseI	CAYNNNNRTG	1 cut(s)	639
SaqAI	TTAA	2 cut(s)	324, 664
Sau3AI	GATC	2 cut(s)	616, 658
SchI	GAGTC	1 cut(s)	442
ScrFI	CCNGG	1 cut(s)	565
SetI	ASST	8 cut(s)	54, 201, 283, 292, 405, 502, 510, 591
SfaNI	GCATC	1 cut(s)	545
SfcI	CTRYAG	1 cut(s)	394
SmiMI	CAYNNNNRTG	1 cut(s)	639
Sse9I	AATT	6 cut(s)	58, 106, 236, 476, 488, 644
StyD4I	CCNGG	1 cut(s)	563
TaaI	ACNGT	4 cut(s)	136, 245, 265, 580
TaiI	ACGT	2 cut(s)	54, 283
TaqI	TCGA	1 cut(s)	502
TasI	AATT	6 cut(s)	58, 106, 236, 476, 488, 644
TatI	WGTACW	1 cut(s)	575
TfiI	GAWTC	3 cut(s)	125, 172, 215
Tru1I	TTAA	2 cut(s)	324, 664
Tru9I	TTAA	2 cut(s)	324, 664
TscAI	CASTG	4 cut(s)	274, 364, 394, 585
TseFI	GTSAC	1 cut(s)	265
Tsp45I	GTSAC	1 cut(s)	265
TspDTI	ATGAA	6 cut(s)	17, 219, 457, 629, 642, 657
TspGWI	ACGGA	1 cut(s)	60
TspRI	CASTG	4 cut(s)	274, 364, 394, 585
XapI	RAATTY	4 cut(s)	58, 106, 476, 488
XceI	RCATGY	1 cut(s)	348
ZraI	GACGTC	1 cut(s)	52

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.