Rmu_sc0014419.1_g000005

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0014419.1
OG0004243
Physical Location & Seq
Reverse (-)
13091 .. 14804
1714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0014419.1_g000005.1.cds

Sequence Viewer

Length: 654 bp
atgcctataaatacccttccaaatcctccaaaatacggagacgtctggaattcgaagacgacggaaaagagcgagagcgataacagcatgggcgaaaattcgcaggagatttacgaatctgaaactgtgttattcaagaagcagggtctctgcaaagaagagaatctgaaccaagtctggaagaaagaggtggaaacagtctttgaatctcatggcctttcatgcgaattgaactgggatgagtgtaagatgactgtcactgcaacagaacgtactgaaggtggtcttcttcaagatggctttgacaggggttttaatgctctctttgttctggcatgtggtctcggcactgaatgggttgaaccaatcgtctccggcagtgtccatagtgatgtcatgaaaattacaataccagatggcatgactgaggatgatttttcaagcaagtataatgatttcatatacaaatttgaacacaaatttggactacctcgaaagctgtcctgctttgttctttatcaagaagcagctgttgttgttctttccgataaagccgggtcaacaagtacagtgaggaatcttgtgtatagttgtcttaatggcgatgatccttttgatgaagaccattttcatgaattgttccttgaagattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

217

Amino Acids

24.54

Weight (kDa)

4.52

Isoelectric Point (pI)

40.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 45
AclWI GGATC 1 cut(s) 602
AcsI RAATTY 4 cut(s) 49, 97, 467, 479
AcuI CTGAAG 1 cut(s) 297
AcyI GRCGYC 1 cut(s) 42
AfaI GTAC 2 cut(s) 274, 568
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 8 cut(s) 136, 206, 232, 293, 362, 441, 473, 647
AjuI GAANNNNNNNTTGG 2 cut(s) 465, 497
AluBI AGCT 2 cut(s) 499, 530
AluI AGCT 2 cut(s) 499, 530
Alw26I GTCTC 4 cut(s) 33, 152, 347, 376
AlwI GGATC 1 cut(s) 602
AoxI GGCC 1 cut(s) 214
ApeKI GCWGC 1 cut(s) 527
ApoI RAATTY 4 cut(s) 49, 97, 467, 479
AsuC2I CCSGG 1 cut(s) 556
AsuII TTCGAA 1 cut(s) 53
BbsI GAAGAC 3 cut(s) 62, 278, 627
BbvI GCAGC 1 cut(s) 539
BccI CCATC 2 cut(s) 290, 410
BcnI CCSGG 1 cut(s) 556
BcoDI GTCTC 4 cut(s) 33, 152, 347, 376
BisI GCNGC 1 cut(s) 528
BlsI GCNGC 1 cut(s) 529
Bme1390I CCNGG 1 cut(s) 556
BmrFI CCNGG 1 cut(s) 556
BmrI ACTGGG 1 cut(s) 244
BmuI ACTGGG 1 cut(s) 244
BpiI GAAGAC 3 cut(s) 62, 278, 627
Bpu14I TTCGAA 1 cut(s) 53
BpuMI CCSGG 1 cut(s) 556
BsaHI GRCGYC 1 cut(s) 42
BsaI GGTCTC 2 cut(s) 152, 347
Bsc4I CCNNNNNNNGG 1 cut(s) 35
Bse1I ACTGG 1 cut(s) 239
BseGI GGATG 2 cut(s) 244, 436
BseLI CCNNNNNNNGG 1 cut(s) 35
BseMII CTCAG 1 cut(s) 417
BseNI ACTGG 1 cut(s) 239
BseXI GCAGC 1 cut(s) 539
BshFI GGCC 1 cut(s) 216
BsiSI CCGG 2 cut(s) 375, 555
BslI CCNNNNNNNGG 1 cut(s) 35
BsmAI GTCTC 4 cut(s) 33, 152, 347, 376
BsmBI CGTCTC 2 cut(s) 33, 376
BsnI GGCC 1 cut(s) 216
Bso31I GGTCTC 2 cut(s) 152, 347
Bsp119I TTCGAA 1 cut(s) 53
Bsp143I GATC 1 cut(s) 607
BspANI GGCC 1 cut(s) 216
BspCNI CTCAG 1 cut(s) 418
BspHI TCATGA 2 cut(s) 396, 631
BspPI GGATC 1 cut(s) 602
BspT104I TTCGAA 1 cut(s) 53
BspTNI GGTCTC 2 cut(s) 152, 347
BsrI ACTGG 1 cut(s) 239
BssMI GATC 1 cut(s) 607
BssNI GRCGYC 1 cut(s) 42
Bst4CI ACNGT 4 cut(s) 127, 199, 256, 571
Bst6I CTCTTC 1 cut(s) 153
BstACI GRCGYC 1 cut(s) 42
BstBI TTCGAA 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 426
BstF5I GGATG 2 cut(s) 244, 436
BstKTI GATC 1 cut(s) 610
BstMAI GTCTC 4 cut(s) 33, 152, 347, 376
BstMBI GATC 1 cut(s) 607
BstMWI GCNNNNNNNGC 2 cut(s) 84, 222
BstNSI RCATGY 1 cut(s) 339
BstSCI CCNGG 1 cut(s) 554
BstV1I GCAGC 1 cut(s) 539
BstV2I GAAGAC 3 cut(s) 62, 278, 627
BsuRI GGCC 1 cut(s) 216
BtgZI GCGATG 1 cut(s) 618
BtsCI GGATG 2 cut(s) 244, 436
BtsI GCAGTG 2 cut(s) 258, 385
BtsIMutI CAGTG 4 cut(s) 258, 348, 385, 576
CciI TCATGA 2 cut(s) 396, 631
Csp6I GTAC 2 cut(s) 273, 567
CviAII CATG 7 cut(s) 88, 212, 222, 336, 397, 421, 632
CviJI RGCY 5 cut(s) 216, 300, 499, 530, 554
CviKI_1 RGCY 5 cut(s) 216, 300, 499, 530, 554
CviQI GTAC 2 cut(s) 273, 567
DdeI CTNAG 1 cut(s) 426
DpnI GATC 1 cut(s) 609
DpnII GATC 1 cut(s) 607
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
Eco31I GGTCTC 2 cut(s) 152, 347
Eco57I CTGAAG 1 cut(s) 297
EcoRI GAATTC 1 cut(s) 49
Esp3I CGTCTC 2 cut(s) 33, 376
FaeI CATG 7 cut(s) 91, 215, 225, 339, 400, 424, 635
FalI AAGNNNNNCTT 2 cut(s) 270, 302
FatI CATG 7 cut(s) 87, 211, 221, 335, 396, 420, 631
Fnu4HI GCNGC 1 cut(s) 528
FokI GGATG 2 cut(s) 251, 443
Fsp4HI GCNGC 1 cut(s) 528
GluI GCNGC 1 cut(s) 528
HaeIII GGCC 1 cut(s) 216
HapII CCGG 2 cut(s) 375, 555
Hin1I GRCGYC 1 cut(s) 42
Hin1II CATG 7 cut(s) 91, 215, 225, 339, 400, 424, 635
HincII GTYRAC 1 cut(s) 561
HindII GTYRAC 1 cut(s) 561
HinfI GANTC 4 cut(s) 116, 163, 206, 577
HpaII CCGG 2 cut(s) 375, 555
Hpy166II GTNNAC 1 cut(s) 561
Hpy188I TCNGA 3 cut(s) 121, 168, 547
Hpy188III TCNNGA 7 cut(s) 46, 136, 178, 293, 397, 521, 632
Hpy8I GTNNAC 1 cut(s) 561
Hpy99I CGWCG 1 cut(s) 64
HpyAV CCTTC 2 cut(s) 26, 272
HpyCH4III ACNGT 4 cut(s) 127, 199, 256, 571
HpyCH4IV ACGT 2 cut(s) 42, 271
HpyCH4V TGCA 2 cut(s) 153, 263
HpyF10VI GCNNNNNNNGC 2 cut(s) 84, 222
HpyF3I CTNAG 1 cut(s) 426
HpySE526I ACGT 2 cut(s) 42, 271
Hsp92I GRCGYC 1 cut(s) 42
Hsp92II CATG 7 cut(s) 91, 215, 225, 339, 400, 424, 635
Kzo9I GATC 1 cut(s) 607
Lsp1109I GCAGC 1 cut(s) 539
MaeII ACGT 2 cut(s) 42, 271
MaeIII GTNAC 1 cut(s) 256
MalI GATC 1 cut(s) 609
MboI GATC 1 cut(s) 607
MboII GAAGA 6 cut(s) 67, 170, 193, 278, 281, 632
MluCI AATT 7 cut(s) 49, 97, 227, 402, 467, 479, 635
MnlI CCTC 5 cut(s) 36, 181, 421, 501, 567
MseI TTAA 2 cut(s) 315, 597
MslI CAYNNNNRTG 2 cut(s) 390, 630
MspA1I CMGCKG 1 cut(s) 530
MspI CCGG 2 cut(s) 375, 555
MspR9I CCNGG 1 cut(s) 556
MwoI GCNNNNNNNGC 2 cut(s) 84, 222
NciI CCSGG 1 cut(s) 556
NdeII GATC 1 cut(s) 607
NlaIII CATG 7 cut(s) 91, 215, 225, 339, 400, 424, 635
NmeAIII GCCGAG 1 cut(s) 324
NmuCI GTSAC 1 cut(s) 256
NspI RCATGY 1 cut(s) 339
NspV TTCGAA 1 cut(s) 53
PagI TCATGA 2 cut(s) 396, 631
PfeI GAWTC 4 cut(s) 116, 163, 206, 577
PkrI GCNGC 1 cut(s) 529
PvuII CAGCTG 1 cut(s) 530
RsaI GTAC 2 cut(s) 274, 568
RsaNI GTAC 2 cut(s) 273, 567
RseI CAYNNNNRTG 2 cut(s) 390, 630
SaqAI TTAA 2 cut(s) 315, 597
SatI GCNGC 1 cut(s) 528
Sau3AI GATC 1 cut(s) 607
ScrFI CCNGG 1 cut(s) 556
SetI ASST 7 cut(s) 45, 192, 274, 283, 493, 501, 532
SfuI TTCGAA 1 cut(s) 53
SmiMI CAYNNNNRTG 2 cut(s) 390, 630
Sse9I AATT 7 cut(s) 49, 97, 227, 402, 467, 479, 635
StyD4I CCNGG 1 cut(s) 554
TaaI ACNGT 4 cut(s) 127, 199, 256, 571
TaiI ACGT 2 cut(s) 45, 274
TaqI TCGA 2 cut(s) 53, 493
TasI AATT 7 cut(s) 49, 97, 227, 402, 467, 479, 635
TatI WGTACW 1 cut(s) 566
TfiI GAWTC 4 cut(s) 116, 163, 206, 577
Tru1I TTAA 2 cut(s) 315, 597
Tru9I TTAA 2 cut(s) 315, 597
TscAI CASTG 4 cut(s) 265, 355, 385, 576
TseFI GTSAC 1 cut(s) 256
TseI GCWGC 1 cut(s) 527
Tsp45I GTSAC 1 cut(s) 256
TspDTI ATGAA 6 cut(s) 210, 413, 448, 620, 633, 648
TspGWI ACGGA 2 cut(s) 51, 77
TspRI CASTG 4 cut(s) 265, 355, 385, 576
XapI RAATTY 4 cut(s) 49, 97, 467, 479
XceI RCATGY 1 cut(s) 339
ZraI GACGTC 1 cut(s) 43
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.