Rmu_sc0006862.1_g000008

isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006862.1
OG0002123
Physical Location & Seq
Reverse (-)
32319 .. 32858
540 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006862.1_g000008.1.cds

Sequence Viewer

Length: 447 bp
atggtttatcaagttgaccatgttcctagtgttccaattggtcctttgtctctactttggatgcctccctttcttccacctggacaggtgactagtatgcatccatttgttctgcatcaacctggggttccccattccatgccaccacagcttcctcaatcacatgtggggaattttcactcaatacctgtaatgtcatctctccaccagtggcagaaccaacaggctccgtccgagagtttgcagatagctacacaaactgaacctccatcttcccaaaatgatcaaaacctgataagatcagatgcaaagtatcactatgaaacttctgttaatgggcaaccatttcatcaagactatttggatgttcaaattcacgaaggggcagagcctgagcctgtgatatcatcttcccccgaggaagcacaggtatttccttgtaaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

148

Amino Acids

16.5

Weight (kDa)

5.22

Isoelectric Point (pI)

83.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 172, 372
AflIII ACRYGT 1 cut(s) 163
AgsI TTSAA 1 cut(s) 371
AhlI ACTAGT 1 cut(s) 92
AjnI CCWGG 2 cut(s) 79, 121
AluBI AGCT 2 cut(s) 151, 251
AluI AGCT 2 cut(s) 151, 251
Alw26I GTCTC 1 cut(s) 54
AlwNI CAGNNNCTG 1 cut(s) 392
Ama87I CYCGRG 1 cut(s) 416
ApoI RAATTY 2 cut(s) 172, 372
AspS9I GGNCC 1 cut(s) 41
AsuHPI GGTGA 1 cut(s) 100
AvaI CYCGRG 1 cut(s) 416
AvaII GGWCC 1 cut(s) 41
BccI CCATC 1 cut(s) 277
BciT130I CCWGG 2 cut(s) 81, 123
BclI TGATCA 1 cut(s) 283
BcoDI GTCTC 1 cut(s) 54
BcuI ACTAGT 1 cut(s) 92
BfaI CTAG 2 cut(s) 27, 93
Bme1390I CCNGG 2 cut(s) 81, 123
Bme18I GGWCC 1 cut(s) 41
BmeT110I CYCGRG 1 cut(s) 416
BmgT120I GGNCC 1 cut(s) 41
BmiI GGNNCC 2 cut(s) 129, 228
BmrFI CCNGG 2 cut(s) 81, 123
BmsI GCATC 4 cut(s) 51, 109, 124, 295
Bpu10I CCTNAGC 1 cut(s) 393
BsaJI CCNNGG 2 cut(s) 122, 417
BsaXI ACNNNNNCTCC 2 cut(s) 250, 280
Bse1I ACTGG 1 cut(s) 208
BseBI CCWGG 2 cut(s) 81, 123
BseDI CCNNGG 2 cut(s) 122, 417
BseGI GGATG 3 cut(s) 66, 100, 370
BseMII CTCAG 1 cut(s) 384
BseNI ACTGG 1 cut(s) 208
BsiHKCI CYCGRG 1 cut(s) 416
BsmAI GTCTC 1 cut(s) 54
BsoBI CYCGRG 1 cut(s) 416
Bsp143I GATC 2 cut(s) 283, 299
BspCNI CTCAG 1 cut(s) 385
BspLI GGNNCC 2 cut(s) 129, 228
BsrI ACTGG 1 cut(s) 208
BssECI CCNNGG 2 cut(s) 122, 417
BssMI GATC 2 cut(s) 283, 299
Bst2UI CCWGG 2 cut(s) 81, 123
BstDEI CTNAG 1 cut(s) 393
BstF5I GGATG 3 cut(s) 66, 100, 370
BstKTI GATC 2 cut(s) 286, 302
BstMAI GTCTC 1 cut(s) 54
BstMBI GATC 2 cut(s) 283, 299
BstMWI GCNNNNNNNGC 1 cut(s) 148
BstNI CCWGG 2 cut(s) 81, 123
BstNSI RCATGY 1 cut(s) 167
BstSCI CCNGG 2 cut(s) 79, 121
BtsCI GGATG 3 cut(s) 66, 100, 370
BtsIMutI CAGTG 1 cut(s) 215
CaiI CAGNNNCTG 1 cut(s) 392
Cfr13I GGNCC 1 cut(s) 41
CviAII CATG 3 cut(s) 20, 139, 164
CviJI RGCY 5 cut(s) 151, 227, 251, 391, 397
CviKI_1 RGCY 5 cut(s) 151, 227, 251, 391, 397
DdeI CTNAG 1 cut(s) 393
DpnI GATC 2 cut(s) 285, 301
DpnII GATC 2 cut(s) 283, 299
Eco32I GATATC 1 cut(s) 405
Eco47I GGWCC 1 cut(s) 41
Eco88I CYCGRG 1 cut(s) 416
EcoRII CCWGG 2 cut(s) 79, 121
EcoRV GATATC 1 cut(s) 405
EcoT22I ATGCAT 1 cut(s) 102
FaeI CATG 3 cut(s) 23, 142, 167
FaiI YATR 5 cut(s) 21, 98, 140, 165, 321
FatI CATG 3 cut(s) 19, 138, 163
FbaI TGATCA 1 cut(s) 283
FokI GGATG 3 cut(s) 73, 87, 377
FspBI CTAG 2 cut(s) 27, 93
Hin1II CATG 3 cut(s) 23, 142, 167
HincII GTYRAC 1 cut(s) 16
HindII GTYRAC 1 cut(s) 16
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 16
Hpy188I TCNGA 2 cut(s) 235, 304
Hpy188III TCNNGA 2 cut(s) 353, 377
Hpy8I GTNNAC 1 cut(s) 16
HpyAV CCTTC 1 cut(s) 374
HpyCH4V TGCA 4 cut(s) 100, 115, 244, 308
HpyF10VI GCNNNNNNNGC 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 393
Hsp92II CATG 3 cut(s) 23, 142, 167
Ksp22I TGATCA 1 cut(s) 283
Kzo9I GATC 2 cut(s) 283, 299
LmnI GCTCC 1 cut(s) 232
LweI GCATC 4 cut(s) 51, 109, 124, 295
MaeI CTAG 2 cut(s) 27, 93
MaeIII GTNAC 1 cut(s) 88
MalI GATC 2 cut(s) 285, 301
MboI GATC 2 cut(s) 283, 299
MboII GAAGA 3 cut(s) 65, 264, 402
MfeI CAATTG 1 cut(s) 36
MluCI AATT 3 cut(s) 36, 172, 372
MnlI CCTC 4 cut(s) 75, 165, 276, 412
Mph1103I ATGCAT 1 cut(s) 102
MseI TTAA 1 cut(s) 333
MspR9I CCNGG 2 cut(s) 81, 123
MunI CAATTG 1 cut(s) 36
MvaI CCWGG 2 cut(s) 81, 123
MwoI GCNNNNNNNGC 1 cut(s) 148
NdeII GATC 2 cut(s) 283, 299
NlaIII CATG 3 cut(s) 23, 142, 167
NlaIV GGNNCC 2 cut(s) 129, 228
NmuCI GTSAC 1 cut(s) 88
NsiI ATGCAT 1 cut(s) 102
NspI RCATGY 1 cut(s) 167
PciI ACATGT 1 cut(s) 163
PscI ACATGT 1 cut(s) 163
Psp6I CCWGG 2 cut(s) 79, 121
PspGI CCWGG 2 cut(s) 79, 121
PspN4I GGNNCC 2 cut(s) 129, 228
PspPI GGNCC 1 cut(s) 41
PstNI CAGNNNCTG 1 cut(s) 392
SaqAI TTAA 1 cut(s) 333
Sau3AI GATC 2 cut(s) 283, 299
Sau96I GGNCC 1 cut(s) 41
ScrFI CCNGG 2 cut(s) 81, 123
SetI ASST 9 cut(s) 82, 90, 124, 153, 190, 253, 268, 294, 432
SfaNI GCATC 4 cut(s) 51, 109, 124, 295
SinI GGWCC 1 cut(s) 41
SpeI ACTAGT 1 cut(s) 92
Sse9I AATT 3 cut(s) 36, 172, 372
SspMI CTAG 2 cut(s) 27, 93
StyD4I CCNGG 2 cut(s) 79, 121
TasI AATT 3 cut(s) 36, 172, 372
Tru1I TTAA 1 cut(s) 333
Tru9I TTAA 1 cut(s) 333
TscAI CASTG 1 cut(s) 215
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 2 cut(s) 336, 338
TspGWI ACGGA 1 cut(s) 219
TspRI CASTG 1 cut(s) 215
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 2 cut(s) 172, 372
XceI RCATGY 1 cut(s) 167
XspI CTAG 2 cut(s) 27, 93
Zsp2I ATGCAT 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.