Rroxscaffold_1G00051710

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000001
Physical Location & Seq
Forward (+)
72399606 .. 72401575
1970 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_1G00051710.1

Sequence Viewer

Length: 192 bp
ATGTGCAACTCCATGAAAAGGAGCAAGCCATGCATGCAGGATTTGGAGATGAAATTACAAGAAAAATATAGAGAGCTGCATCCTACCAAATTAGATAATGAAGCGGTTAGTTATATGTTTATGAAATTTCTCTTGGTTGCTTTAGCTGAGCAATTTGTAATTTTTACCCACTTTCATAATTTATATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.63

Weight (kDa)

7.81

Isoelectric Point (pI)

39.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 104
AcsI RAATTY 1 cut(s) 125
AfiI CCNNNNNNNGG 1 cut(s) 18
AjuI GAANNNNNNNTTGG 2 cut(s) 116, 148
AluBI AGCT 2 cut(s) 76, 146
AluI AGCT 2 cut(s) 76, 146
ApeKI GCWGC 1 cut(s) 76
ApoI RAATTY 1 cut(s) 125
BbvI GCAGC 1 cut(s) 63
BisI GCNGC 1 cut(s) 77
BlpI GCTNAGC 1 cut(s) 147
BlsI GCNGC 1 cut(s) 78
BmsI GCATC 1 cut(s) 88
Bpu1102I GCTNAGC 1 cut(s) 147
Bsc4I CCNNNNNNNGG 1 cut(s) 18
BseGI GGATG 1 cut(s) 79
BseLI CCNNNNNNNGG 1 cut(s) 18
BseMII CTCAG 1 cut(s) 138
BseXI GCAGC 1 cut(s) 63
BslI CCNNNNNNNGG 1 cut(s) 18
Bsp1720I GCTNAGC 1 cut(s) 147
BspACI CCGC 1 cut(s) 104
BspCNI CTCAG 1 cut(s) 139
BstAPI GCANNNNNTGC 1 cut(s) 30
BstC8I GCNNGC 2 cut(s) 26, 35
BstDEI CTNAG 1 cut(s) 147
BstF5I GGATG 1 cut(s) 79
BstMWI GCNNNNNNNGC 2 cut(s) 30, 34
BstNSI RCATGY 1 cut(s) 37
BstV1I GCAGC 1 cut(s) 63
BtsCI GGATG 1 cut(s) 79
Cac8I GCNNGC 2 cut(s) 26, 35
CviAII CATG 3 cut(s) 13, 30, 34
CviJI RGCY 3 cut(s) 28, 76, 146
CviKI_1 RGCY 3 cut(s) 28, 76, 146
DdeI CTNAG 1 cut(s) 147
EcoT22I ATGCAT 1 cut(s) 35
FaeI CATG 3 cut(s) 16, 33, 37
FatI CATG 3 cut(s) 12, 29, 33
Fnu4HI GCNGC 1 cut(s) 77
FokI GGATG 1 cut(s) 66
Fsp4HI GCNGC 1 cut(s) 77
GluI GCNGC 1 cut(s) 77
Hin1II CATG 3 cut(s) 16, 33, 37
HpyCH4V TGCA 4 cut(s) 6, 33, 37, 79
HpyF10VI GCNNNNNNNGC 2 cut(s) 30, 34
HpyF3I CTNAG 1 cut(s) 147
Hsp92II CATG 3 cut(s) 16, 33, 37
LmnI GCTCC 1 cut(s) 21
LpnPI CCDG 1 cut(s) 23
Lsp1109I GCAGC 1 cut(s) 63
LweI GCATC 1 cut(s) 88
MluCI AATT 6 cut(s) 53, 89, 125, 152, 159, 178
Mph1103I ATGCAT 1 cut(s) 35
MwoI GCNNNNNNNGC 2 cut(s) 30, 34
NlaIII CATG 3 cut(s) 16, 33, 37
NsiI ATGCAT 1 cut(s) 35
NspI RCATGY 1 cut(s) 37
PaeI GCATGC 1 cut(s) 37
PkrI GCNGC 1 cut(s) 78
SatI GCNGC 1 cut(s) 77
SetI ASST 2 cut(s) 78, 148
SfaNI GCATC 1 cut(s) 88
SgeI CNNG 7 cut(s) 25, 37, 42, 46, 50, 71, 145
SphI GCATGC 1 cut(s) 37
Sse9I AATT 6 cut(s) 53, 89, 125, 152, 159, 178
SsiI CCGC 1 cut(s) 104
TasI AATT 6 cut(s) 53, 89, 125, 152, 159, 178
TseI GCWGC 1 cut(s) 76
TspDTI ATGAA 5 cut(s) 29, 65, 114, 137, 164
XapI RAATTY 1 cut(s) 125
XceI RCATGY 1 cut(s) 37
Zsp2I ATGCAT 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.