Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0017237.1

Orthogroup ID

OG0002123

Physical Location & Seq

Genomic Coordinates Forward (+)

2248 .. 3386

Gene Structure 1139 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0017237.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 711 bp

atggtttatcaagttgaccatgttcctagtgttccaattggtcctttgtctctactttggatgcctccctttcttccacctggacaggtgactagtatgcatccatttgttctgcatcaacctggggttccccattccatgccaccacagcttcctcaatcacatgtggggaattttcactcaatacctgtaatgtcatctctccaacagtggcagaaccaacagatagctacacaaactgaacctccatcttcccaaaatgatcaaaacctgataagatcagatgcaaagtatcactatgaaacttctgttaatgggcaaccatttcatcaagactatttggatgttcaaattcacgaaggggcagagcctgagcctgtgatatcatcttcccccgaggaagcacaggcacatgagcagaatgttcagaccttgatcgatcatgggttggacggacaagttttaacggctgagaaaccaaattctgctaccaagtcctcaaaatctgacactccaatccatggagctcctctggacaaatcaatggccaatggcctgctgagctcaaattttgttgggaaacagcatggcaggtatgcctctaaaccttcaaacatacttggaagacacttgaactcgtttcctgtattttgcttattgtgttgttactttgacatgatgactaattctgcatttacctccagaagatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

236

Amino Acids

26.09

Weight (kDa)

6.01

Isoelectric Point (pI)

62.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002123)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G53620 AT5G53620 AT5G53620
fragaria_vesca	FvH4_7g32660 FvH4_7g32660 FvH4_7g32660 FvH4_7g32660
malus_domestica	MD01G1227300.v1.1 MD07G1297600.v1.1
prunus_persica	Prupe.2G317300_v2.0.a1 Prupe.2G317300_v2.0.a1 Prupe.2G317300_v2.0.a1 Prupe.2G317300_v2.0.a1 Prupe.2G317300_v2.0.a1
pyrus_communis	pycom01g23540 pycom07g27000
rosa_chinensis	RchiOBHm_Chr1g0382521 RchiOBHm_Chr1g0382561 RchiOBHm_Chr1g0382611 RchiOBHm_Chr1g0382631 RchiOBHm_Chr1g0382641
rosa_laevigata	RLG00000026170
rosa_multiflora	Rmu_co8064912.1_g000001 Rmu_sc0000110.1_g000056 Rmu_sc0006862.1_g000005 Rmu_sc0006862.1_g000008 Rmu_sc0006862.1_g000011 Rmu_sc0017237.1_g000002 Rmu_sc0017237.1_g000006
rosa_roxburghii	Rroxscaffold_1G00051710 Rroxscaffold_4G00277980 Rroxscaffold_4G00277990
rosa_rugosa	Rorug01G0435100 Rorug01G0435200 Rorug01G0435300 Rorug01G0435300
rosa_samantha	Rh1AG460200 Rh1BG416400 Rh1BG416500 Rh1BG416800 Rh1CG430200 Rh1DG448800 Rh1DG449000
rosa_wichuraiana	Rw1G041150

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	582
AccB7I	CCANNNNNTGG	1 cut(s)	521
AcoI	YGGCCR	1 cut(s)	546
AcsI	RAATTY	4 cut(s)	172, 351, 481, 568
AfiI	CCNNNNNNNGG	1 cut(s)	521
AflIII	ACRYGT	1 cut(s)	163
AgsI	TTSAA	3 cut(s)	350, 612, 634
AhlI	ACTAGT	1 cut(s)	92
AjnI	CCWGG	2 cut(s)	79, 121
AluBI	AGCT	4 cut(s)	151, 230, 527, 564
AluI	AGCT	4 cut(s)	151, 230, 527, 564
Alw21I	GWGCWC	2 cut(s)	529, 566
Alw26I	GTCTC	1 cut(s)	54
AlwNI	CAGNNNCTG	1 cut(s)	371
Ama87I	CYCGRG	1 cut(s)	395
AoxI	GGCC	2 cut(s)	546, 553
ApoI	RAATTY	4 cut(s)	172, 351, 481, 568
AspS9I	GGNCC	1 cut(s)	41
AsuHPI	GGTGA	1 cut(s)	100
AvaI	CYCGRG	1 cut(s)	395
AvaII	GGWCC	1 cut(s)	41
BalI	TGGCCA	1 cut(s)	548
BanII	GRGCYC	2 cut(s)	529, 566
BbsI	GAAGAC	1 cut(s)	631
Bbv12I	GWGCWC	2 cut(s)	529, 566
BccI	CCATC	1 cut(s)	256
BceAI	ACGGC	1 cut(s)	483
BciT130I	CCWGG	2 cut(s)	81, 123
BclI	TGATCA	1 cut(s)	262
BcoDI	GTCTC	1 cut(s)	54
BcuI	ACTAGT	1 cut(s)	92
BfaI	CTAG	2 cut(s)	27, 93
BfuAI	ACCTGC	1 cut(s)	582
BlpI	GCTNAGC	1 cut(s)	560
Bme1390I	CCNGG	2 cut(s)	81, 123
Bme18I	GGWCC	1 cut(s)	41
BmeT110I	CYCGRG	1 cut(s)	395
BmgT120I	GGNCC	1 cut(s)	41
BmiI	GGNNCC	1 cut(s)	129
BmrFI	CCNGG	2 cut(s)	81, 123
BmsI	GCATC	4 cut(s)	51, 109, 124, 274
BpiI	GAAGAC	1 cut(s)	631
BpmI	CTGGAG	1 cut(s)	685
Bpu10I	CCTNAGC	1 cut(s)	372
Bpu1102I	GCTNAGC	1 cut(s)	560
Bsa29I	ATCGAT	1 cut(s)	438
BsaJI	CCNNGG	3 cut(s)	122, 396, 520
BsaXI	ACNNNNNCTCC	2 cut(s)	229, 259
Bsc4I	CCNNNNNNNGG	1 cut(s)	521
BseBI	CCWGG	2 cut(s)	81, 123
BseCI	ATCGAT	1 cut(s)	438
BseDI	CCNNGG	3 cut(s)	122, 396, 520
BseGI	GGATG	3 cut(s)	66, 100, 349
BseLI	CCNNNNNNNGG	1 cut(s)	521
BseMII	CTCAG	3 cut(s)	363, 462, 551
BseRI	GAGGAG	1 cut(s)	519
BshFI	GGCC	2 cut(s)	548, 555
BshVI	ATCGAT	1 cut(s)	438
BsiHKAI	GWGCWC	2 cut(s)	529, 566
BsiHKCI	CYCGRG	1 cut(s)	395
BslI	CCNNNNNNNGG	1 cut(s)	521
BsmAI	GTCTC	1 cut(s)	54
BsnI	GGCC	2 cut(s)	548, 555
BsoBI	CYCGRG	1 cut(s)	395
Bsp1286I	GDGCHC	2 cut(s)	529, 566
Bsp143I	GATC	4 cut(s)	262, 278, 435, 439
Bsp1720I	GCTNAGC	1 cut(s)	560
Bsp19I	CCATGG	1 cut(s)	520
BspANI	GGCC	2 cut(s)	548, 555
BspCNI	CTCAG	3 cut(s)	364, 463, 552
BspDI	ATCGAT	1 cut(s)	438
BspLI	GGNNCC	1 cut(s)	129
BspMI	ACCTGC	1 cut(s)	582
BssECI	CCNNGG	3 cut(s)	122, 396, 520
BssMI	GATC	4 cut(s)	262, 278, 435, 439
BssT1I	CCWWGG	1 cut(s)	520
Bst2UI	CCWGG	2 cut(s)	81, 123
Bst4CI	ACNGT	1 cut(s)	210
BstC8I	GCNNGC	1 cut(s)	557
BstDEI	CTNAG	3 cut(s)	372, 471, 560
BstDSI	CCRYGG	1 cut(s)	520
BstF5I	GGATG	3 cut(s)	66, 100, 349
BstKTI	GATC	4 cut(s)	265, 281, 438, 442
BstMAI	GTCTC	1 cut(s)	54
BstMBI	GATC	4 cut(s)	262, 278, 435, 439
BstMWI	GCNNNNNNNGC	2 cut(s)	148, 561
BstNI	CCWGG	2 cut(s)	81, 123
BstNSI	RCATGY	1 cut(s)	167
BstSCI	CCNGG	2 cut(s)	79, 121
BstV2I	GAAGAC	1 cut(s)	631
Bsu15I	ATCGAT	1 cut(s)	438
BsuRI	GGCC	2 cut(s)	548, 555
BsuTUI	ATCGAT	1 cut(s)	438
BtgI	CCRYGG	1 cut(s)	520
BtsCI	GGATG	3 cut(s)	66, 100, 349
BtsIMutI	CAGTG	1 cut(s)	215
BveI	ACCTGC	1 cut(s)	582
Cac8I	GCNNGC	1 cut(s)	557
CaiI	CAGNNNCTG	1 cut(s)	371
Cfr13I	GGNCC	1 cut(s)	41
ClaI	ATCGAT	1 cut(s)	438
CviAII	CATG	8 cut(s)	20, 139, 164, 413, 443, 521, 587, 676
CviJI	RGCY	9 cut(s)	151, 230, 370, 376, 470, 527, 548, 555, 564
CviKI_1	RGCY	9 cut(s)	151, 230, 370, 376, 470, 527, 548, 555, 564
DdeI	CTNAG	3 cut(s)	372, 471, 560
DpnI	GATC	4 cut(s)	264, 280, 437, 441
DpnII	GATC	4 cut(s)	262, 278, 435, 439
EaeI	YGGCCR	1 cut(s)	546
Ecl136II	GAGCTC	2 cut(s)	527, 564
Eco130I	CCWWGG	1 cut(s)	520
Eco24I	GRGCYC	2 cut(s)	529, 566
Eco32I	GATATC	1 cut(s)	384
Eco47I	GGWCC	1 cut(s)	41
Eco53kI	GAGCTC	2 cut(s)	527, 564
Eco88I	CYCGRG	1 cut(s)	395
EcoICRI	GAGCTC	2 cut(s)	527, 564
EcoRII	CCWGG	2 cut(s)	79, 121
EcoRV	GATATC	1 cut(s)	384
EcoT14I	CCWWGG	1 cut(s)	520
EcoT22I	ATGCAT	1 cut(s)	102
EcoT38I	GRGCYC	2 cut(s)	529, 566
ErhI	CCWWGG	1 cut(s)	520
FaeI	CATG	8 cut(s)	23, 142, 167, 416, 446, 524, 590, 679
FatI	CATG	8 cut(s)	19, 138, 163, 412, 442, 520, 586, 675
FbaI	TGATCA	1 cut(s)	262
FokI	GGATG	3 cut(s)	73, 87, 356
FriOI	GRGCYC	2 cut(s)	529, 566
FspBI	CTAG	2 cut(s)	27, 93
GsuI	CTGGAG	1 cut(s)	685
HaeIII	GGCC	2 cut(s)	548, 555
Hin1II	CATG	8 cut(s)	23, 142, 167, 416, 446, 524, 590, 679
HincII	GTYRAC	1 cut(s)	16
HindII	GTYRAC	1 cut(s)	16
HphI	GGTGA	1 cut(s)	100
Hpy166II	GTNNAC	1 cut(s)	16
Hpy188I	TCNGA	3 cut(s)	283, 429, 508
Hpy188III	TCNNGA	4 cut(s)	332, 356, 533, 702
Hpy8I	GTNNAC	1 cut(s)	16
HpyAV	CCTTC	2 cut(s)	353, 618
HpyCH4III	ACNGT	1 cut(s)	210
HpyCH4V	TGCA	4 cut(s)	100, 115, 287, 692
HpyF10VI	GCNNNNNNNGC	2 cut(s)	148, 561
HpyF3I	CTNAG	3 cut(s)	372, 471, 560
Hsp92II	CATG	8 cut(s)	23, 142, 167, 416, 446, 524, 590, 679
Ksp22I	TGATCA	1 cut(s)	262
Kzo9I	GATC	4 cut(s)	262, 278, 435, 439
LmnI	GCTCC	2 cut(s)	524, 532
LweI	GCATC	4 cut(s)	51, 109, 124, 274
MaeI	CTAG	2 cut(s)	27, 93
MaeIII	GTNAC	2 cut(s)	88, 665
MalI	GATC	4 cut(s)	264, 280, 437, 441
MboI	GATC	4 cut(s)	262, 278, 435, 439
MboII	GAAGA	4 cut(s)	65, 243, 381, 636
MfeI	CAATTG	1 cut(s)	36
MhlI	GDGCHC	2 cut(s)	529, 566
MlsI	TGGCCA	1 cut(s)	548
MluCI	AATT	6 cut(s)	36, 172, 351, 481, 568, 685
MluNI	TGGCCA	1 cut(s)	548
MmeI	TCCRAC	2 cut(s)	229, 429
MnlI	CCTC	8 cut(s)	75, 165, 255, 391, 508, 540, 610, 709
Mox20I	TGGCCA	1 cut(s)	548
Mph1103I	ATGCAT	1 cut(s)	102
MscI	TGGCCA	1 cut(s)	548
MseI	TTAA	2 cut(s)	312, 464
Msp20I	TGGCCA	1 cut(s)	548
MspR9I	CCNGG	2 cut(s)	81, 123
MunI	CAATTG	1 cut(s)	36
MvaI	CCWGG	2 cut(s)	81, 123
MwoI	GCNNNNNNNGC	2 cut(s)	148, 561
NcoI	CCATGG	1 cut(s)	520
NdeII	GATC	4 cut(s)	262, 278, 435, 439
NlaIII	CATG	8 cut(s)	23, 142, 167, 416, 446, 524, 590, 679
NlaIV	GGNNCC	1 cut(s)	129
NmuCI	GTSAC	1 cut(s)	88
NsiI	ATGCAT	1 cut(s)	102
NspI	RCATGY	1 cut(s)	167
PciI	ACATGT	1 cut(s)	163
PflMI	CCANNNNNTGG	1 cut(s)	521
PscI	ACATGT	1 cut(s)	163
Psp124BI	GAGCTC	2 cut(s)	529, 566
Psp6I	CCWGG	2 cut(s)	79, 121
PspGI	CCWGG	2 cut(s)	79, 121
PspN4I	GGNNCC	1 cut(s)	129
PspPI	GGNCC	1 cut(s)	41
PstNI	CAGNNNCTG	1 cut(s)	371
SacI	GAGCTC	2 cut(s)	529, 566
SaqAI	TTAA	2 cut(s)	312, 464
Sau3AI	GATC	4 cut(s)	262, 278, 435, 439
Sau96I	GGNCC	1 cut(s)	41
ScrFI	CCNGG	2 cut(s)	81, 123
SduI	GDGCHC	2 cut(s)	529, 566
SfaNI	GCATC	4 cut(s)	51, 109, 124, 274
SinI	GGWCC	1 cut(s)	41
SpeI	ACTAGT	1 cut(s)	92
Sse9I	AATT	6 cut(s)	36, 172, 351, 481, 568, 685
SspMI	CTAG	2 cut(s)	27, 93
SstI	GAGCTC	2 cut(s)	529, 566
StyD4I	CCNGG	2 cut(s)	79, 121
StyI	CCWWGG	1 cut(s)	520
TaaI	ACNGT	1 cut(s)	210
TaqI	TCGA	1 cut(s)	438
TasI	AATT	6 cut(s)	36, 172, 351, 481, 568, 685
Tru1I	TTAA	2 cut(s)	312, 464
Tru9I	TTAA	2 cut(s)	312, 464
TscAI	CASTG	1 cut(s)	215
TseFI	GTSAC	1 cut(s)	88
Tsp45I	GTSAC	1 cut(s)	88
TspDTI	ATGAA	2 cut(s)	315, 317
TspGWI	ACGGA	1 cut(s)	468
TspRI	CASTG	1 cut(s)	215
Van91I	CCANNNNNTGG	1 cut(s)	521
VpaK11BI	GGWCC	1 cut(s)	41
XapI	RAATTY	4 cut(s)	172, 351, 481, 568
XceI	RCATGY	1 cut(s)	167
XspI	CTAG	2 cut(s)	27, 93
Zsp2I	ATGCAT	1 cut(s)	102

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.