Rmu_sc0007879.1_g000009

reductase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007879.1
OG0003527
Physical Location & Seq
Forward (+)
61195 .. 61587
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007879.1_g000009.1.cds

Sequence Viewer

Length: 348 bp
atggggatgttcgtcttctttggccccctgaagcccgaaccaaacatgatcaaactcatcaaccacgccaccgacaccggtgtcaccttccttgatactgctgacctttatggtcccttcaccaatgaacttcttctcgacaagcttatttggattgttgacttgaataaatcgttaagccttttgagtggaggggtgggagacaagcttgaattggtcaacaaattcgatatcaaatttgaggacaacaagagagagattattcgaggggagccggcacatgtgggagctgttagtgaaggaatcttgaaacaccttcgtgtagactctattgatctctattattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Aldo_ket_red

Protein Analysis

115

Amino Acids

12.91

Weight (kDa)

5.05

Isoelectric Point (pI)

18.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 80
AccI GTMKAC 1 cut(s) 324
AcsI RAATTY 2 cut(s) 224, 236
AcuI CTGAAG 1 cut(s) 50
AflIII ACRYGT 1 cut(s) 280
AgeI ACCGGT 1 cut(s) 77
AgsI TTSAA 3 cut(s) 166, 212, 310
AleI CACNNNNGTG 1 cut(s) 318
AluBI AGCT 3 cut(s) 145, 208, 290
AluI AGCT 3 cut(s) 145, 208, 290
Alw26I GTCTC 1 cut(s) 195
AoxI GGCC 1 cut(s) 22
ApoI RAATTY 2 cut(s) 224, 236
AsiGI ACCGGT 1 cut(s) 77
Asp700I GAANNNNTTC 1 cut(s) 132
AspS9I GGNCC 2 cut(s) 23, 113
AsuHPI GGTGA 2 cut(s) 76, 112
AvaII GGWCC 1 cut(s) 113
BbsI GAAGAC 1 cut(s) 7
BclI TGATCA 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 195
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 2 cut(s) 23, 113
BmiI GGNNCC 3 cut(s) 25, 115, 273
BpiI GAAGAC 1 cut(s) 7
BsaWI WCCGGW 1 cut(s) 77
Bse118I RCCGGY 2 cut(s) 77, 274
BseGI GGATG 1 cut(s) 12
BshFI GGCC 1 cut(s) 24
BshTI ACCGGT 1 cut(s) 77
BsiSI CCGG 2 cut(s) 78, 275
BslFI GGGAC 1 cut(s) 99
BsmAI GTCTC 1 cut(s) 195
BsmFI GGGAC 1 cut(s) 99
BsnI GGCC 1 cut(s) 24
Bsp143I GATC 2 cut(s) 48, 334
BspANI GGCC 1 cut(s) 24
BspLI GGNNCC 3 cut(s) 25, 115, 273
BsrFI RCCGGY 2 cut(s) 77, 274
BssAI RCCGGY 2 cut(s) 77, 274
BssMI GATC 2 cut(s) 48, 334
BstC8I GCNNGC 1 cut(s) 276
BstF5I GGATG 1 cut(s) 12
BstKTI GATC 2 cut(s) 51, 337
BstMAI GTCTC 1 cut(s) 195
BstMBI GATC 2 cut(s) 48, 334
BstNSI RCATGY 1 cut(s) 284
BstV2I GAAGAC 1 cut(s) 7
BsuRI GGCC 1 cut(s) 24
BtsCI GGATG 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 276
Cfr10I RCCGGY 2 cut(s) 77, 274
Cfr13I GGNCC 2 cut(s) 23, 113
CspAI ACCGGT 1 cut(s) 77
CviAII CATG 2 cut(s) 46, 281
CviJI RGCY 7 cut(s) 24, 34, 145, 180, 208, 274, 290
CviKI_1 RGCY 7 cut(s) 24, 34, 145, 180, 208, 274, 290
DpnI GATC 2 cut(s) 50, 336
DpnII GATC 2 cut(s) 48, 334
DrdI GACNNNNNNGTC 1 cut(s) 80
DseDI GACNNNNNNGTC 1 cut(s) 80
Eco32I GATATC 1 cut(s) 232
Eco47I GGWCC 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 50
EcoRV GATATC 1 cut(s) 232
FaeI CATG 2 cut(s) 49, 284
FaiI YATR 3 cut(s) 47, 111, 282
FaqI GGGAC 1 cut(s) 99
FatI CATG 2 cut(s) 45, 280
FbaI TGATCA 1 cut(s) 48
FblI GTMKAC 1 cut(s) 324
FokI GGATG 1 cut(s) 19
HaeIII GGCC 1 cut(s) 24
HapII CCGG 2 cut(s) 78, 275
Hin1II CATG 2 cut(s) 49, 284
HincII GTYRAC 2 cut(s) 160, 220
HindII GTYRAC 2 cut(s) 160, 220
HindIII AAGCTT 2 cut(s) 143, 206
HinfI GANTC 2 cut(s) 303, 326
HpaII CCGG 2 cut(s) 78, 275
HphI GGTGA 2 cut(s) 76, 112
Hpy166II GTNNAC 3 cut(s) 160, 220, 325
Hpy188III TCNNGA 2 cut(s) 137, 307
Hpy8I GTNNAC 3 cut(s) 160, 220, 325
HpyAV CCTTC 4 cut(s) 97, 127, 293, 326
Hsp92II CATG 2 cut(s) 49, 284
KroI GCCGGC 1 cut(s) 274
KroNI GCCGGC 1 cut(s) 276
Ksp22I TGATCA 1 cut(s) 48
Kzo9I GATC 2 cut(s) 48, 334
LmnI GCTCC 2 cut(s) 271, 287
LpnPI CCDG 3 cut(s) 41, 91, 288
MaeIII GTNAC 1 cut(s) 82
MalI GATC 2 cut(s) 50, 336
MboI GATC 2 cut(s) 48, 334
MboII GAAGA 2 cut(s) 7, 125
MluCI AATT 3 cut(s) 212, 224, 236
MlyI GAGTC 1 cut(s) 320
MnlI CCTC 3 cut(s) 185, 235, 260
MroNI GCCGGC 1 cut(s) 274
MroXI GAANNNNTTC 1 cut(s) 132
MseI TTAA 1 cut(s) 176
MslI CAYNNNNRTG 1 cut(s) 318
MspI CCGG 2 cut(s) 78, 275
NaeI GCCGGC 1 cut(s) 276
NdeII GATC 2 cut(s) 48, 334
NgoMIV GCCGGC 1 cut(s) 274
NlaIII CATG 2 cut(s) 49, 284
NlaIV GGNNCC 3 cut(s) 25, 115, 273
NmuCI GTSAC 1 cut(s) 82
NspI RCATGY 1 cut(s) 284
OliI CACNNNNGTG 1 cut(s) 318
PciI ACATGT 1 cut(s) 280
PdiI GCCGGC 1 cut(s) 276
PdmI GAANNNNTTC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 303
PinAI ACCGGT 1 cut(s) 77
PleI GAGTC 1 cut(s) 320
PpsI GAGTC 1 cut(s) 320
PscI ACATGT 1 cut(s) 280
PspN4I GGNNCC 3 cut(s) 25, 115, 273
PspPI GGNCC 2 cut(s) 23, 113
RseI CAYNNNNRTG 1 cut(s) 318
SaqAI TTAA 1 cut(s) 176
Sau3AI GATC 2 cut(s) 48, 334
Sau96I GGNCC 2 cut(s) 23, 113
SchI GAGTC 1 cut(s) 320
SetI ASST 6 cut(s) 89, 108, 147, 210, 292, 318
SgrAI CRCCGGYG 1 cut(s) 77
SinI GGWCC 1 cut(s) 113
SmiMI CAYNNNNRTG 1 cut(s) 318
Sse9I AATT 3 cut(s) 212, 224, 236
TaqI TCGA 3 cut(s) 138, 228, 265
TasI AATT 3 cut(s) 212, 224, 236
TfiI GAWTC 1 cut(s) 303
Tru1I TTAA 1 cut(s) 176
Tru9I TTAA 1 cut(s) 176
TseFI GTSAC 1 cut(s) 82
Tsp45I GTSAC 1 cut(s) 82
TspDTI ATGAA 1 cut(s) 141
VpaK11BI GGWCC 1 cut(s) 113
XapI RAATTY 2 cut(s) 224, 236
XceI RCATGY 1 cut(s) 284
XmiI GTMKAC 1 cut(s) 324
XmnI GAANNNNTTC 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.