Rmu_sc0022645.1_g000001

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0022645.1
Physical Location & Seq
Reverse (-)
1 .. 646
646 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0022645.1_g000001.1.cds

Sequence Viewer

Length: 195 bp
atgttcaagttcaaggttggtgaatattgtgagaaggaactagggtacaacaacagatctgagtttgtgccaacttatgaagacaaagatggagattggatgcttcttggagatgttccatgggagatgtttttcacttcatgcaagaggctgagaattatgaaaggttcagaagccaaaggcttaggttgtgcg

Protein Analysis

65

Amino Acids

7.58

Weight (kDa)

5.33

Isoelectric Point (pI)

32.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 47
AgsI TTSAA 2 cut(s) 7, 13
AsuHPI GGTGA 1 cut(s) 32
BbsI GAAGAC 1 cut(s) 87
BccI CCATC 1 cut(s) 83
BfaI CTAG 1 cut(s) 41
BglII AGATCT 1 cut(s) 56
BmsI GCATC 1 cut(s) 90
BpiI GAAGAC 1 cut(s) 87
Bpu10I CCTNAGC 1 cut(s) 184
BsaJI CCNNGG 1 cut(s) 119
BseDI CCNNGG 1 cut(s) 119
BseGI GGATG 1 cut(s) 105
BseMII CTCAG 2 cut(s) 51, 143
Bsp143I GATC 1 cut(s) 56
Bsp19I CCATGG 1 cut(s) 119
BspCNI CTCAG 2 cut(s) 52, 144
BssECI CCNNGG 1 cut(s) 119
BssMI GATC 1 cut(s) 56
BssT1I CCWWGG 1 cut(s) 119
BstDEI CTNAG 3 cut(s) 60, 152, 184
BstDSI CCRYGG 1 cut(s) 119
BstF5I GGATG 1 cut(s) 105
BstKTI GATC 1 cut(s) 59
BstMBI GATC 1 cut(s) 56
BstV2I GAAGAC 1 cut(s) 87
BstX2I RGATCY 1 cut(s) 56
BstYI RGATCY 1 cut(s) 56
BtgI CCRYGG 1 cut(s) 119
BtsCI GGATG 1 cut(s) 105
Csp6I GTAC 1 cut(s) 46
CviAII CATG 2 cut(s) 120, 141
CviJI RGCY 3 cut(s) 151, 176, 183
CviKI_1 RGCY 3 cut(s) 151, 176, 183
CviQI GTAC 1 cut(s) 46
DdeI CTNAG 3 cut(s) 60, 152, 184
DpnI GATC 1 cut(s) 58
DpnII GATC 1 cut(s) 56
Eco130I CCWWGG 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 119
ErhI CCWWGG 1 cut(s) 119
FaeI CATG 2 cut(s) 123, 144
FaiI YATR 4 cut(s) 78, 121, 142, 161
FatI CATG 2 cut(s) 119, 140
FokI GGATG 1 cut(s) 112
FspBI CTAG 1 cut(s) 41
Hin1II CATG 2 cut(s) 123, 144
HphI GGTGA 1 cut(s) 32
Hpy188I TCNGA 2 cut(s) 61, 172
HpyAV CCTTC 1 cut(s) 28
HpyCH4V TGCA 1 cut(s) 144
HpyF3I CTNAG 3 cut(s) 60, 152, 184
Hsp92II CATG 2 cut(s) 123, 144
Kzo9I GATC 1 cut(s) 56
LweI GCATC 1 cut(s) 90
MaeI CTAG 1 cut(s) 41
MalI GATC 1 cut(s) 58
MboI GATC 1 cut(s) 56
MboII GAAGA 1 cut(s) 92
MflI RGATCY 1 cut(s) 56
MluCI AATT 1 cut(s) 156
MnlI CCTC 1 cut(s) 141
NcoI CCATGG 1 cut(s) 119
NdeII GATC 1 cut(s) 56
NlaIII CATG 2 cut(s) 123, 144
PsuI RGATCY 1 cut(s) 56
RsaI GTAC 1 cut(s) 47
RsaNI GTAC 1 cut(s) 46
Sau3AI GATC 1 cut(s) 56
SetI ASST 3 cut(s) 18, 169, 190
SfaNI GCATC 1 cut(s) 90
SgeI CNNG 7 cut(s) 19, 25, 53, 119, 132, 153, 157
Sse9I AATT 1 cut(s) 156
SspI AATATT 1 cut(s) 26
SspMI CTAG 1 cut(s) 41
StyI CCWWGG 1 cut(s) 119
TasI AATT 1 cut(s) 156
TspDTI ATGAA 3 cut(s) 93, 129, 176
XspI CTAG 1 cut(s) 41
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.