Rorug06G0204800

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
OG0001518
Physical Location & Seq
Reverse (-)
32663580 .. 32665017
1438 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0204800.1

Sequence Viewer

Length: 657 bp
ATGAGCTGTTCAAACTTACGTGATCTTGGTACTTTGGTTACTGGAAATCCTGGCTTCATTGACTACAGAGTGGCTCCTCTGTCAAAATTTGGGAACTACTCATGTCAAAACACAAGTGGAGGACCAAGGATAACTCTTAGGTGCAATAGTTGTCAACCAATTCAAGACAATATGTATATTTCCTGGCAGTTCATTGATCTTCCTGATAATCCTGCTGCTGCTGTTGGATTTCAGTTCAATCTTACTGCAAGGAGTCATGCTAATAAAAGACATCTGAGTTTTGTTAGTGGAACCCTAGAGAATGGAAGTACTTTGGATGATAGACCAGTTACATTCAGAGGGAGTAATACAAATATATTGAAATTCAGTTTATTTCCACGAATATACCATAATCTACATGATCTAAGGCTCATCCAACCTTTGTTTCATGTGTTTGTACTGGGTTCATTCTTTAATGACACAAGTCAGCTCCAAGCATCCCTTCAAAGGCCTAAGGATGGAATACTTAACACCACATTGTACATCAACTTCCTCTCTGGCTACATTGTGGAGATAGATAAGCAAAATATTATGGGTCCTGTGAGCTTCCTTGCTGATCTTGGCGGCTTGTATTGCATCTCCATTGGCATATTTTTCTACCTTCTGGTGCAAGTATGA

Protein Analysis

218

Amino Acids

24.38

Weight (kDa)

8.29

Isoelectric Point (pI)

37.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 603
AcsI RAATTY 2 cut(s) 86, 362
AfaI GTAC 4 cut(s) 31, 310, 438, 521
AfiI CCNNNNNNNGG 2 cut(s) 486, 497
AgsI TTSAA 5 cut(s) 12, 164, 238, 361, 485
AjnI CCWGG 2 cut(s) 49, 182
AjuI GAANNNNNNNTTGG 4 cut(s) 408, 440, 465, 497
AluBI AGCT 3 cut(s) 6, 469, 585
AluI AGCT 3 cut(s) 6, 469, 585
AoxI GGCC 1 cut(s) 488
ApeKI GCWGC 2 cut(s) 215, 218
ApoI RAATTY 2 cut(s) 86, 362
AspS9I GGNCC 2 cut(s) 122, 575
AvaII GGWCC 2 cut(s) 122, 575
AxyI CCTNAGG 1 cut(s) 492
BaeI ACNNNNGTAYC 2 cut(s) 21, 54
BarI GAAGNNNNNNTAC 2 cut(s) 512, 544
BbvI GCAGC 2 cut(s) 202, 205
BccI CCATC 1 cut(s) 491
BciT130I CCWGG 2 cut(s) 51, 184
BfaI CTAG 1 cut(s) 296
BfmI CTRYAG 1 cut(s) 64
BisI GCNGC 3 cut(s) 216, 219, 604
BlsI GCNGC 3 cut(s) 217, 220, 605
BmcAI AGTACT 1 cut(s) 310
Bme1390I CCNGG 2 cut(s) 51, 184
Bme18I GGWCC 2 cut(s) 122, 575
BmgT120I GGNCC 2 cut(s) 122, 575
BmiI GGNNCC 3 cut(s) 75, 292, 576
BmrFI CCNGG 2 cut(s) 51, 184
BmrI ACTGGG 1 cut(s) 449
BmsI GCATC 2 cut(s) 485, 624
BmuI ACTGGG 1 cut(s) 449
BoxI GACNNNNGTC 1 cut(s) 462
BsaAI YACGTR 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 125
Bsc4I CCNNNNNNNGG 2 cut(s) 486, 497
Bse1I ACTGG 3 cut(s) 46, 326, 444
Bse21I CCTNAGG 1 cut(s) 492
BseBI CCWGG 2 cut(s) 51, 184
BseDI CCNNGG 1 cut(s) 125
BseGI GGATG 4 cut(s) 322, 411, 476, 502
BseLI CCNNNNNNNGG 2 cut(s) 486, 497
BseMII CTCAG 1 cut(s) 266
BseNI ACTGG 3 cut(s) 46, 326, 444
BseRI GAGGAG 1 cut(s) 66
BseXI GCAGC 2 cut(s) 202, 205
BshFI GGCC 1 cut(s) 490
BslI CCNNNNNNNGG 2 cut(s) 486, 497
BsnI GGCC 1 cut(s) 490
Bsp1407I TGTACA 1 cut(s) 519
Bsp143I GATC 4 cut(s) 22, 196, 400, 595
BspACI CCGC 1 cut(s) 603
BspANI GGCC 1 cut(s) 490
BspCNI CTCAG 1 cut(s) 267
BspLI GGNNCC 3 cut(s) 75, 292, 576
BsrGI TGTACA 1 cut(s) 519
BsrI ACTGG 3 cut(s) 46, 326, 444
BssECI CCNNGG 1 cut(s) 125
BssMI GATC 4 cut(s) 22, 196, 400, 595
BssT1I CCWWGG 1 cut(s) 125
Bst2UI CCWGG 2 cut(s) 51, 184
BstAUI TGTACA 1 cut(s) 519
BstBAI YACGTR 1 cut(s) 20
BstDEI CTNAG 4 cut(s) 137, 275, 404, 492
BstF5I GGATG 4 cut(s) 322, 411, 476, 502
BstKTI GATC 4 cut(s) 25, 199, 403, 598
BstMBI GATC 4 cut(s) 22, 196, 400, 595
BstMWI GCNNNNNNNGC 1 cut(s) 612
BstNI CCWGG 2 cut(s) 51, 184
BstPAI GACNNNNGTC 1 cut(s) 462
BstSCI CCNGG 2 cut(s) 49, 182
BstSFI CTRYAG 1 cut(s) 64
BstV1I GCAGC 2 cut(s) 202, 205
Bsu36I CCTNAGG 1 cut(s) 492
BsuRI GGCC 1 cut(s) 490
BtsCI GGATG 4 cut(s) 322, 411, 476, 502
Cfr13I GGNCC 2 cut(s) 122, 575
Csp6I GTAC 4 cut(s) 30, 309, 437, 520
CviAII CATG 4 cut(s) 102, 257, 398, 428
CviJI RGCY 9 cut(s) 6, 54, 74, 409, 469, 490, 540, 585, 606
CviKI_1 RGCY 9 cut(s) 6, 54, 74, 409, 469, 490, 540, 585, 606
CviQI GTAC 4 cut(s) 30, 309, 437, 520
DdeI CTNAG 4 cut(s) 137, 275, 404, 492
DpnI GATC 4 cut(s) 24, 198, 402, 597
DpnII GATC 4 cut(s) 22, 196, 400, 595
Eco130I CCWWGG 1 cut(s) 125
Eco147I AGGCCT 1 cut(s) 490
Eco47I GGWCC 2 cut(s) 122, 575
Eco81I CCTNAGG 1 cut(s) 492
EcoO109I RGGNCCY 1 cut(s) 575
EcoRII CCWGG 2 cut(s) 49, 182
EcoT14I CCWWGG 1 cut(s) 125
ErhI CCWWGG 1 cut(s) 125
FaeI CATG 4 cut(s) 105, 260, 401, 431
FalI AAGNNNNNCTT 2 cut(s) 465, 497
FatI CATG 4 cut(s) 101, 256, 397, 427
Fnu4HI GCNGC 3 cut(s) 216, 219, 604
FokI GGATG 4 cut(s) 329, 398, 463, 509
Fsp4HI GCNGC 3 cut(s) 216, 219, 604
FspBI CTAG 1 cut(s) 296
GluI GCNGC 3 cut(s) 216, 219, 604
HaeIII GGCC 1 cut(s) 490
Hin1II CATG 4 cut(s) 105, 260, 401, 431
HincII GTYRAC 1 cut(s) 155
HindII GTYRAC 1 cut(s) 155
HinfI GANTC 1 cut(s) 253
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 2 cut(s) 276, 338
Hpy188III TCNNGA 2 cut(s) 164, 203
Hpy8I GTNNAC 1 cut(s) 155
HpyAV CCTTC 2 cut(s) 491, 650
HpyCH4IV ACGT 1 cut(s) 19
HpyCH4V TGCA 4 cut(s) 144, 248, 615, 649
HpyF10VI GCNNNNNNNGC 1 cut(s) 612
HpyF3I CTNAG 4 cut(s) 137, 275, 404, 492
HpySE526I ACGT 1 cut(s) 19
Hsp92II CATG 4 cut(s) 105, 260, 401, 431
Kzo9I GATC 4 cut(s) 22, 196, 400, 595
LmnI GCTCC 2 cut(s) 79, 474
Lsp1109I GCAGC 2 cut(s) 202, 205
LweI GCATC 2 cut(s) 485, 624
MaeI CTAG 1 cut(s) 296
MaeII ACGT 1 cut(s) 19
MaeIII GTNAC 2 cut(s) 37, 328
MalI GATC 4 cut(s) 24, 198, 402, 597
MboI GATC 4 cut(s) 22, 196, 400, 595
MboII GAAGA 1 cut(s) 191
MluCI AATT 3 cut(s) 86, 159, 362
MlyI GAGTC 1 cut(s) 262
MmeI TCCRAC 2 cut(s) 205, 439
MnlI CCTC 4 cut(s) 87, 113, 332, 542
MseI TTAA 2 cut(s) 453, 507
MspR9I CCNGG 2 cut(s) 51, 184
MvaI CCWGG 2 cut(s) 51, 184
MwoI GCNNNNNNNGC 1 cut(s) 612
NdeII GATC 4 cut(s) 22, 196, 400, 595
NlaIII CATG 4 cut(s) 105, 260, 401, 431
NlaIV GGNNCC 3 cut(s) 75, 292, 576
PceI AGGCCT 1 cut(s) 490
PkrI GCNGC 3 cut(s) 217, 220, 605
PleI GAGTC 1 cut(s) 261
PpsI GAGTC 1 cut(s) 261
Ppu21I YACGTR 1 cut(s) 20
PpuMI RGGWCCY 1 cut(s) 575
PshAI GACNNNNGTC 1 cut(s) 462
Psp5II RGGWCCY 1 cut(s) 575
Psp6I CCWGG 2 cut(s) 49, 182
PspGI CCWGG 2 cut(s) 49, 182
PspN4I GGNNCC 3 cut(s) 75, 292, 576
PspPI GGNCC 2 cut(s) 122, 575
PspPPI RGGWCCY 1 cut(s) 575
RsaI GTAC 4 cut(s) 31, 310, 438, 521
RsaNI GTAC 4 cut(s) 30, 309, 437, 520
SaqAI TTAA 2 cut(s) 453, 507
SatI GCNGC 3 cut(s) 216, 219, 604
Sau3AI GATC 4 cut(s) 22, 196, 400, 595
Sau96I GGNCC 2 cut(s) 122, 575
ScaI AGTACT 1 cut(s) 310
SchI GAGTC 1 cut(s) 262
ScrFI CCNGG 2 cut(s) 51, 184
SetI ASST 7 cut(s) 8, 22, 143, 421, 471, 587, 642
SfaNI GCATC 2 cut(s) 485, 624
SfcI CTRYAG 1 cut(s) 64
SinI GGWCC 2 cut(s) 122, 575
Sse9I AATT 3 cut(s) 86, 159, 362
SseBI AGGCCT 1 cut(s) 490
SsiI CCGC 1 cut(s) 603
SspI AATATT 1 cut(s) 568
SspMI CTAG 1 cut(s) 296
StuI AGGCCT 1 cut(s) 490
StyD4I CCNGG 2 cut(s) 49, 182
StyI CCWWGG 1 cut(s) 125
TaiI ACGT 1 cut(s) 22
TasI AATT 3 cut(s) 86, 159, 362
TatI WGTACW 3 cut(s) 308, 436, 519
TauI GCSGC 1 cut(s) 606
Tru1I TTAA 2 cut(s) 453, 507
Tru9I TTAA 2 cut(s) 453, 507
TseI GCWGC 2 cut(s) 215, 218
TspDTI ATGAA 4 cut(s) 46, 181, 416, 435
VpaK11BI GGWCC 2 cut(s) 122, 575
XapI RAATTY 2 cut(s) 86, 362
XspI CTAG 1 cut(s) 296
ZrmI AGTACT 1 cut(s) 310
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.