Rmu_sc0041627.1_g000001

5'-3' exoribonuclease

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0041627.1
Physical Location & Seq
Forward (+)
13 .. 1507
1495 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0041627.1_g000001.1.cds

Sequence Viewer

Length: 810 bp
atggaggatataatggacaaccaagtcatatgtgcaatatacagactaccagatgtacacgagcatataactcgaccaccagcaggggtcattttccctaagaagattgtgtcatcgggggatatgaagcctgcacctgttttgtggcatgaggattcagggaggaagccatggcatgacaattcggggaggaggccatatgaaagttctagacagcaccctcctggagccatttctggaagacagcttggcgatgccgctcatcgacttgttgttaatagtttacatgttaaggcaaacggcaatgggtatggcaatcagatggctgcccatcaatcatatgccgaacctccatattacccaccacgggcttcctacgcaagtaatggaagctatgatcagggacaccacagtatggcaccacctagaacattccagcatcctcaagtgcaacaccaaaattcctaccaccctccgaatagacatcattctcaacattatgaaagaaattctggtcactcgtactctcagtcggcccgtcatcagaatggtggaattgcttacccccagagaccaattacaccagctccaccaggggtcaatccaggtccttatccagttggttataacaactatcagagttaccaacaagcagggccgcctggttatcaaggcattgatgcgtgggttccaccgccccaaaatatgggcagaggatatggtcgtcctcagcaatctggaaacccgtactctggattggacaggagaggaaataggagaccacctccatcccagcatggccgcaagtag

Protein Analysis

269

Amino Acids

29.98

Weight (kDa)

9.75

Isoelectric Point (pI)

57.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 627
AasI GACNNNNNNGTC 1 cut(s) 23
AccB1I GGYRCC 1 cut(s) 418
AccB7I CCANNNNNTGG 2 cut(s) 415, 706
AccBSI CCGCTC 1 cut(s) 260
AciI CCGC 4 cut(s) 258, 659, 695, 802
AcoI YGGCCR 1 cut(s) 799
AcsI RAATTY 2 cut(s) 460, 508
AfaI GTAC 3 cut(s) 57, 524, 749
AfiI CCNNNNNNNGG 5 cut(s) 83, 367, 415, 706, 752
AflIII ACRYGT 1 cut(s) 286
AjnI CCWGG 4 cut(s) 223, 592, 604, 661
AluBI AGCT 3 cut(s) 247, 393, 587
AluI AGCT 3 cut(s) 247, 393, 587
Alw26I GTCTC 2 cut(s) 565, 772
AoxI GGCC 4 cut(s) 194, 534, 656, 799
ApeKI GCWGC 1 cut(s) 326
ApoI RAATTY 2 cut(s) 460, 508
AspS9I GGNCC 3 cut(s) 535, 608, 656
AvaII GGWCC 1 cut(s) 608
BanI GGYRCC 1 cut(s) 418
BauI CACGAG 1 cut(s) 59
BbsI GAAGAC 1 cut(s) 247
BbvCI CCTCAGC 1 cut(s) 729
BbvI GCAGC 1 cut(s) 313
BccI CCATC 3 cut(s) 316, 339, 796
BceAI ACGGC 1 cut(s) 316
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BciT130I CCWGG 4 cut(s) 225, 594, 606, 663
BclI TGATCA 1 cut(s) 397
BcoDI GTCTC 2 cut(s) 565, 772
BfaI CTAG 2 cut(s) 210, 426
BisI GCNGC 4 cut(s) 258, 327, 659, 802
BlsI GCNGC 4 cut(s) 259, 328, 660, 803
Bme1390I CCNGG 4 cut(s) 225, 594, 606, 663
Bme18I GGWCC 1 cut(s) 608
BmgT120I GGNCC 3 cut(s) 535, 608, 656
BmiI GGNNCC 3 cut(s) 229, 420, 690
BmrFI CCNGG 4 cut(s) 225, 594, 606, 663
BmsI GCATC 3 cut(s) 244, 448, 670
BpiI GAAGAC 1 cut(s) 247
BplI GAGNNNNNCTC 2 cut(s) 769, 801
BpmI CTGGAG 1 cut(s) 246
Bpu10I CCTNAGC 1 cut(s) 729
BpuEI CTTGAG 1 cut(s) 429
BsaI GGTCTC 2 cut(s) 565, 772
BsaJI CCNNGG 3 cut(s) 170, 365, 593
BsaXI ACNNNNNCTCC 2 cut(s) 571, 601
Bsc4I CCNNNNNNNGG 5 cut(s) 83, 367, 415, 706, 752
Bse1I ACTGG 1 cut(s) 617
Bse3DI GCAATG 1 cut(s) 310
BseBI CCWGG 4 cut(s) 225, 594, 606, 663
BseDI CCNNGG 3 cut(s) 170, 365, 593
BseGI GGATG 2 cut(s) 439, 788
BseLI CCNNNNNNNGG 5 cut(s) 83, 367, 415, 706, 752
BseMI GCAATG 1 cut(s) 310
BseMII CTCAG 2 cut(s) 542, 743
BseNI ACTGG 1 cut(s) 617
BseRI GAGGAG 1 cut(s) 205
BseXI GCAGC 1 cut(s) 313
BseYI CCCAGC 1 cut(s) 792
BsgI GTGCAG 1 cut(s) 117
BshFI GGCC 4 cut(s) 196, 536, 658, 801
BshNI GGYRCC 1 cut(s) 418
BslFI GGGAC 1 cut(s) 417
BslI CCNNNNNNNGG 5 cut(s) 83, 367, 415, 706, 752
BsmAI GTCTC 2 cut(s) 565, 772
BsmFI GGGAC 1 cut(s) 417
BsnI GGCC 4 cut(s) 196, 536, 658, 801
Bso31I GGTCTC 2 cut(s) 565, 772
Bsp1407I TGTACA 1 cut(s) 55
Bsp143I GATC 1 cut(s) 397
Bsp19I CCATGG 1 cut(s) 170
BspACI CCGC 4 cut(s) 258, 659, 695, 802
BspANI GGCC 4 cut(s) 196, 536, 658, 801
BspCNI CTCAG 2 cut(s) 541, 742
BspLI GGNNCC 3 cut(s) 229, 420, 690
BspT107I GGYRCC 1 cut(s) 418
BspTNI GGTCTC 2 cut(s) 565, 772
BsrBI CCGCTC 1 cut(s) 260
BsrDI GCAATG 1 cut(s) 310
BsrGI TGTACA 1 cut(s) 55
BsrI ACTGG 1 cut(s) 617
BssECI CCNNGG 3 cut(s) 170, 365, 593
BssMI GATC 1 cut(s) 397
BssSI CACGAG 1 cut(s) 59
BssT1I CCWWGG 1 cut(s) 170
Bst2BI CACGAG 1 cut(s) 59
Bst2UI CCWGG 4 cut(s) 225, 594, 606, 663
Bst4CI ACNGT 1 cut(s) 413
BstAUI TGTACA 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 132
BstDEI CTNAG 3 cut(s) 99, 528, 729
BstDSI CCRYGG 2 cut(s) 170, 365
BstF5I GGATG 2 cut(s) 439, 788
BstKTI GATC 1 cut(s) 400
BstMAI GTCTC 2 cut(s) 565, 772
BstMBI GATC 1 cut(s) 397
BstMWI GCNNNNNNNGC 1 cut(s) 377
BstNI CCWGG 4 cut(s) 225, 594, 606, 663
BstNSI RCATGY 1 cut(s) 290
BstSCI CCNGG 4 cut(s) 223, 592, 604, 661
BstV1I GCAGC 1 cut(s) 313
BstV2I GAAGAC 1 cut(s) 247
BsuRI GGCC 4 cut(s) 196, 536, 658, 801
BtgI CCRYGG 2 cut(s) 170, 365
BtgZI GCGATG 1 cut(s) 267
BtsCI GGATG 2 cut(s) 439, 788
Cac8I GCNNGC 1 cut(s) 132
Cfr13I GGNCC 3 cut(s) 535, 608, 656
Csp6I GTAC 3 cut(s) 56, 523, 748
CviAII CATG 5 cut(s) 149, 171, 176, 287, 797
CviQI GTAC 3 cut(s) 56, 523, 748
DdeI CTNAG 3 cut(s) 99, 528, 729
DpnI GATC 1 cut(s) 399
DpnII GATC 1 cut(s) 397
DrdI GACNNNNNNGTC 1 cut(s) 23
DseDI GACNNNNNNGTC 1 cut(s) 23
EaeI YGGCCR 1 cut(s) 799
Eco130I CCWWGG 1 cut(s) 170
Eco31I GGTCTC 2 cut(s) 565, 772
Eco47I GGWCC 1 cut(s) 608
EcoO109I RGGNCCY 1 cut(s) 608
EcoRII CCWGG 4 cut(s) 223, 592, 604, 661
EcoT14I CCWWGG 1 cut(s) 170
ErhI CCWWGG 1 cut(s) 170
FaeI CATG 5 cut(s) 152, 174, 179, 290, 800
FaqI GGGAC 1 cut(s) 417
FatI CATG 5 cut(s) 148, 170, 175, 286, 796
FauNDI CATATG 3 cut(s) 29, 199, 340
FbaI TGATCA 1 cut(s) 397
Fnu4HI GCNGC 4 cut(s) 258, 327, 659, 802
FokI GGATG 2 cut(s) 426, 775
Fsp4HI GCNGC 4 cut(s) 258, 327, 659, 802
FspBI CTAG 2 cut(s) 210, 426
GluI GCNGC 4 cut(s) 258, 327, 659, 802
GsaI CCCAGC 1 cut(s) 796
GsuI CTGGAG 1 cut(s) 246
HaeIII GGCC 4 cut(s) 196, 536, 658, 801
Hin1II CATG 5 cut(s) 152, 174, 179, 290, 800
HinfI GANTC 1 cut(s) 155
Hpy166II GTNNAC 2 cut(s) 58, 284
Hpy188I TCNGA 4 cut(s) 321, 477, 546, 639
Hpy188III TCNNGA 4 cut(s) 210, 237, 738, 753
Hpy8I GTNNAC 2 cut(s) 58, 284
HpyCH4III ACNGT 1 cut(s) 413
HpyCH4V TGCA 3 cut(s) 35, 134, 451
HpyF10VI GCNNNNNNNGC 1 cut(s) 377
HpyF3I CTNAG 3 cut(s) 99, 528, 729
Hsp92II CATG 5 cut(s) 152, 174, 179, 290, 800
Ksp22I TGATCA 1 cut(s) 397
Kzo9I GATC 1 cut(s) 397
LmnI GCTCC 2 cut(s) 227, 592
Lsp1109I GCAGC 1 cut(s) 313
LweI GCATC 3 cut(s) 244, 448, 670
MaeI CTAG 2 cut(s) 210, 426
MaeIII GTNAC 2 cut(s) 515, 641
MalI GATC 1 cut(s) 399
MbiI CCGCTC 1 cut(s) 260
MboI GATC 1 cut(s) 397
MboII GAAGA 2 cut(s) 115, 252
MluCI AATT 5 cut(s) 181, 460, 508, 555, 576
MseI TTAA 2 cut(s) 276, 291
MslI CAYNNNNRTG 1 cut(s) 546
MspR9I CCNGG 4 cut(s) 225, 594, 606, 663
MvaI CCWGG 4 cut(s) 225, 594, 606, 663
MwoI GCNNNNNNNGC 1 cut(s) 377
NcoI CCATGG 1 cut(s) 170
NdeI CATATG 3 cut(s) 29, 199, 340
NdeII GATC 1 cut(s) 397
NlaIII CATG 5 cut(s) 152, 174, 179, 290, 800
NlaIV GGNNCC 3 cut(s) 229, 420, 690
NmuCI GTSAC 1 cut(s) 515
NspI RCATGY 1 cut(s) 290
PciI ACATGT 1 cut(s) 286
PfeI GAWTC 1 cut(s) 155
PflMI CCANNNNNTGG 2 cut(s) 415, 706
PfoI TCCNGGA 1 cut(s) 223
PkrI GCNGC 4 cut(s) 259, 328, 660, 803
PpuMI RGGWCCY 1 cut(s) 608
PscI ACATGT 1 cut(s) 286
PsiI TTATAA 1 cut(s) 627
Psp5II RGGWCCY 1 cut(s) 608
Psp6I CCWGG 4 cut(s) 223, 592, 604, 661
PspFI CCCAGC 1 cut(s) 792
PspGI CCWGG 4 cut(s) 223, 592, 604, 661
PspN4I GGNNCC 3 cut(s) 229, 420, 690
PspPI GGNCC 3 cut(s) 535, 608, 656
PspPPI RGGWCCY 1 cut(s) 608
RsaI GTAC 3 cut(s) 57, 524, 749
RsaNI GTAC 3 cut(s) 56, 523, 748
RseI CAYNNNNRTG 1 cut(s) 546
SaqAI TTAA 2 cut(s) 276, 291
SatI GCNGC 4 cut(s) 258, 327, 659, 802
Sau3AI GATC 1 cut(s) 397
Sau96I GGNCC 3 cut(s) 535, 608, 656
ScrFI CCNGG 4 cut(s) 225, 594, 606, 663
SetI ASST 8 cut(s) 139, 249, 352, 395, 427, 589, 610, 787
SfaNI GCATC 3 cut(s) 244, 448, 670
SinI GGWCC 1 cut(s) 608
SmiMI CAYNNNNRTG 1 cut(s) 546
SmlI CTYRAG 1 cut(s) 444
SmoI CTYRAG 1 cut(s) 444
Sse9I AATT 5 cut(s) 181, 460, 508, 555, 576
SsiI CCGC 4 cut(s) 258, 659, 695, 802
SspMI CTAG 2 cut(s) 210, 426
StyD4I CCNGG 4 cut(s) 223, 592, 604, 661
StyI CCWWGG 1 cut(s) 170
TaaI ACNGT 1 cut(s) 413
TaqI TCGA 2 cut(s) 73, 265
TasI AATT 5 cut(s) 181, 460, 508, 555, 576
TatI WGTACW 1 cut(s) 55
TauI GCSGC 3 cut(s) 260, 661, 804
TfiI GAWTC 1 cut(s) 155
Tru1I TTAA 2 cut(s) 276, 291
Tru9I TTAA 2 cut(s) 276, 291
TseFI GTSAC 1 cut(s) 515
TseI GCWGC 1 cut(s) 326
Tsp45I GTSAC 1 cut(s) 515
TspDTI ATGAA 3 cut(s) 140, 216, 516
Van91I CCANNNNNTGG 2 cut(s) 415, 706
VpaK11BI GGWCC 1 cut(s) 608
XapI RAATTY 2 cut(s) 460, 508
XbaI TCTAGA 1 cut(s) 209
XceI RCATGY 1 cut(s) 290
XspI CTAG 2 cut(s) 210, 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.