Rorug03G0051600

U3 small nucleolar ribonucleoprotein protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000003
Physical Location & Seq
Reverse (-)
4027654 .. 4028109
456 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug03G0051600.1

Sequence Viewer

Length: 456 bp
ATGGATGGCAGAGAACAGCATCTTCAATCGCTAGGCATTTGCCAAAGGCTCTACAACTTCATCATGAGAAGCCTAGCCTCACAAGCCTTCAAGAGTGTGAATTTAGGCCCTCCAATGATTCAAGGCTTACCCTCAATTCCTGAGGATGCTGTACACCCGAATCCCCCGTCTTCTTGTCCAGATGTTATTAAAGAGGAAATAGAAGCTCAAATACCATCAATTGCTTCTCAAGCAAAACCTCCAAGGAAAACAGTTAGCATAAATGATGAAGTCGAGGATATAGAGAAAACTCTGAAGTTGAGAAGAAAAAACTCAAAAAAGAGCAAATCATACGAAAAGTTGAATTCGTTAGAGCCACCAAGCAATGAGCAAATCCCTCTGAGAGCATCAATTCTGAAGGTGGGTTCTGATTTGAGCAAGAAGATGGCTACATTTGTGAATCATAACTACAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

151

Amino Acids

16.86

Weight (kDa)

9.1

Isoelectric Point (pI)

55.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 100, 343
AcuI CTGAAG 2 cut(s) 314, 416
AfaI GTAC 1 cut(s) 153
AgsI TTSAA 4 cut(s) 26, 91, 122, 343
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
AoxI GGCC 1 cut(s) 106
ApoI RAATTY 2 cut(s) 100, 343
ArsI GACNNNNNNTTYG 2 cut(s) 152, 184
AspS9I GGNCC 1 cut(s) 107
AxyI CCTNAGG 1 cut(s) 141
BarI GAAGNNNNNNTAC 2 cut(s) 195, 227
BbsI GAAGAC 1 cut(s) 162
BccI CCATC 2 cut(s) 223, 418
BfaI CTAG 2 cut(s) 32, 74
BmgT120I GGNCC 1 cut(s) 107
BmsI GCATC 3 cut(s) 28, 136, 395
BpiI GAAGAC 1 cut(s) 162
BpuEI CTTGAG 1 cut(s) 213
BsaJI CCNNGG 1 cut(s) 242
Bse21I CCTNAGG 1 cut(s) 141
Bse3DI GCAATG 1 cut(s) 370
BseDI CCNNGG 1 cut(s) 242
BseGI GGATG 2 cut(s) 10, 151
BseMI GCAATG 1 cut(s) 370
BseMII CTCAG 2 cut(s) 132, 371
BshFI GGCC 1 cut(s) 108
BsnI GGCC 1 cut(s) 108
Bsp1407I TGTACA 1 cut(s) 151
BspANI GGCC 1 cut(s) 108
BspCNI CTCAG 2 cut(s) 133, 372
BspHI TCATGA 1 cut(s) 63
BsrDI GCAATG 1 cut(s) 370
BsrGI TGTACA 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 242
BssT1I CCWWGG 1 cut(s) 242
Bst4CI ACNGT 1 cut(s) 253
BstAUI TGTACA 1 cut(s) 151
BstDEI CTNAG 2 cut(s) 141, 380
BstF5I GGATG 2 cut(s) 10, 151
BstMWI GCNNNNNNNGC 2 cut(s) 83, 230
BstV2I GAAGAC 1 cut(s) 162
Bsu36I CCTNAGG 1 cut(s) 141
BsuRI GGCC 1 cut(s) 108
BtsCI GGATG 2 cut(s) 10, 151
CciI TCATGA 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 107
Csp6I GTAC 1 cut(s) 152
CviAII CATG 1 cut(s) 64
CviJI RGCY 9 cut(s) 49, 72, 77, 86, 108, 126, 206, 355, 428
CviKI_1 RGCY 9 cut(s) 49, 72, 77, 86, 108, 126, 206, 355, 428
CviQI GTAC 1 cut(s) 152
DdeI CTNAG 2 cut(s) 141, 380
Eco130I CCWWGG 1 cut(s) 242
Eco57I CTGAAG 2 cut(s) 314, 416
Eco81I CCTNAGG 1 cut(s) 141
EcoO109I RGGNCCY 1 cut(s) 107
EcoRI GAATTC 1 cut(s) 343
EcoT14I CCWWGG 1 cut(s) 242
ErhI CCWWGG 1 cut(s) 242
FaeI CATG 1 cut(s) 67
FaiI YATR 5 cut(s) 65, 260, 281, 331, 444
FatI CATG 1 cut(s) 63
FokI GGATG 2 cut(s) 17, 158
FspBI CTAG 2 cut(s) 32, 74
HaeIII GGCC 1 cut(s) 108
Hin1II CATG 1 cut(s) 67
HinfI GANTC 3 cut(s) 118, 160, 439
Hpy166II GTNNAC 1 cut(s) 154
Hpy188I TCNGA 4 cut(s) 294, 381, 396, 409
Hpy188III TCNNGA 4 cut(s) 64, 91, 140, 179
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 2 cut(s) 97, 391
HpyCH4III ACNGT 1 cut(s) 253
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 230
HpyF3I CTNAG 2 cut(s) 141, 380
Hsp92II CATG 1 cut(s) 67
LpnPI CCDG 2 cut(s) 153, 192
LweI GCATC 3 cut(s) 28, 136, 395
MaeI CTAG 2 cut(s) 32, 74
MboII GAAGA 4 cut(s) 14, 162, 315, 433
MfeI CAATTG 1 cut(s) 219
MluCI AATT 5 cut(s) 100, 135, 219, 343, 390
MnlI CCTC 8 cut(s) 88, 120, 136, 142, 187, 249, 268, 387
MseI TTAA 1 cut(s) 189
MunI CAATTG 1 cut(s) 219
MwoI GCNNNNNNNGC 2 cut(s) 83, 230
NlaIII CATG 1 cut(s) 67
PagI TCATGA 1 cut(s) 63
PfeI GAWTC 3 cut(s) 118, 160, 439
PspPI GGNCC 1 cut(s) 107
RsaI GTAC 1 cut(s) 153
RsaNI GTAC 1 cut(s) 152
SaqAI TTAA 1 cut(s) 189
Sau96I GGNCC 1 cut(s) 107
SetI ASST 3 cut(s) 208, 241, 402
SfaNI GCATC 3 cut(s) 28, 136, 395
SmlI CTYRAG 1 cut(s) 228
SmoI CTYRAG 1 cut(s) 228
Sse9I AATT 5 cut(s) 100, 135, 219, 343, 390
SspMI CTAG 2 cut(s) 32, 74
StyI CCWWGG 1 cut(s) 242
TaaI ACNGT 1 cut(s) 253
TaqI TCGA 1 cut(s) 273
TasI AATT 5 cut(s) 100, 135, 219, 343, 390
TatI WGTACW 1 cut(s) 151
TfiI GAWTC 3 cut(s) 118, 160, 439
Tru1I TTAA 1 cut(s) 189
Tru9I TTAA 1 cut(s) 189
TspDTI ATGAA 2 cut(s) 49, 282
XapI RAATTY 2 cut(s) 100, 343
XspI CTAG 2 cut(s) 32, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.