Rorug05G0593900

Chaperone protein which promotes assembly of the 20S proteasome as part of a heterodimer with PSMG1

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
Physical Location & Seq
Reverse (-)
79164968 .. 79165696
729 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0593900.1

Sequence Viewer

Length: 729 bp
ATGGAATTCTACCACAACCAACTCAAGCTCAGGTTATTGAATGAGAAGAAACCCAGTGTCTACAAAAGAGTTGATTGGCTGGTTGACAAGCTGGGTACCCAAGTGCATTCCTATTTCTGGCTTGATGAATACTCTGAGAAGGATGATTTTGCACGATACTGGAAAGATGAGTGGGTGAACGGTTTAACAGCTTGGCGAACTGCTTTGGAGATTCCAGACTCTAATGTTGTCATTGAAGGTACACGTGCAAAAGTAACAGACCAGCTTGATCAAGAAAAGGCTTATGTTGTTTGGAACCCTGGTTCACAATTCAGTATTTGCAACTGCAGTTGGGCAGAAATGGGGAACCTGTGTGAGCATATACTCAAGGTTATTAGTGTCTGCAGGAAAAGAAGTCATCATGTGCCATCTGTCAGCTTATTGCAGTTCCACCAGGCCTTGCTTGATATGCTCCATTGCCCACCTCATGATTCTTTAATTCGTGATCATGCTGTTTCTTTAGCGGTCTTTGTACAGAACCAGTTAAGTGGACCTAATTTGGAAAGCAGCAATAGCACAATGGATCAGGCAGCTTTAGCCGATAAAGATCTAGAAATAGTAAATGAGGGCCCAGTAAGTGAAGAAGTATTATCTCATAATGAGAATAGTTGTGCGGATGAGCATGTTGCTGTGGGTGCTGAAACGAGTAGTCCAGTTGCTTGTGGAAATGGCATATATAATGAGGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

242

Amino Acids

27.34

Weight (kDa)

5.06

Isoelectric Point (pI)

31.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 95
AccB1I GGYRCC 1 cut(s) 95
AccI GTMKAC 1 cut(s) 60
AciI CCGC 2 cut(s) 503, 653
AclWI GGATC 1 cut(s) 570
AcsI RAATTY 1 cut(s) 5
AcvI CACGTG 1 cut(s) 245
AfaI GTAC 3 cut(s) 97, 241, 513
AfiI CCNNNNNNNGG 1 cut(s) 117
AflIII ACRYGT 1 cut(s) 242
AgsI TTSAA 2 cut(s) 40, 236
AjnI CCWGG 2 cut(s) 298, 432
AloI GAACNNNNNNTCC 2 cut(s) 286, 318
AluBI AGCT 6 cut(s) 28, 91, 191, 265, 417, 572
AluI AGCT 6 cut(s) 28, 91, 191, 265, 417, 572
AlwI GGATC 1 cut(s) 570
AoxI GGCC 2 cut(s) 435, 607
ApaI GGGCCC 1 cut(s) 611
ApeKI GCWGC 2 cut(s) 546, 569
ApoI RAATTY 1 cut(s) 5
Asp718I GGTACC 1 cut(s) 95
AspS9I GGNCC 3 cut(s) 530, 607, 608
AsuHPI GGTGA 1 cut(s) 187
AvaII GGWCC 1 cut(s) 530
BaeGI GKGCMC 1 cut(s) 611
BaeI ACNNNNGTAYC 2 cut(s) 87, 120
BanI GGYRCC 1 cut(s) 95
BanII GRGCYC 1 cut(s) 611
BbrPI CACGTG 1 cut(s) 245
BbvI GCAGC 2 cut(s) 558, 581
BccI CCATC 1 cut(s) 415
BciT130I CCWGG 2 cut(s) 300, 434
BclI TGATCA 2 cut(s) 268, 484
BfaI CTAG 1 cut(s) 590
BfmI CTRYAG 2 cut(s) 325, 382
BglII AGATCT 1 cut(s) 586
BisI GCNGC 2 cut(s) 547, 570
BlsI GCNGC 2 cut(s) 548, 571
Bme1390I CCNGG 2 cut(s) 300, 434
Bme18I GGWCC 1 cut(s) 530
BmgT120I GGNCC 3 cut(s) 530, 607, 608
BmiI GGNNCC 4 cut(s) 97, 296, 347, 609
BmrFI CCNGG 2 cut(s) 300, 434
BmrI ACTGGG 2 cut(s) 48, 605
BmuI ACTGGG 2 cut(s) 48, 605
Bpu10I CCTNAGC 1 cut(s) 29
BpuEI CTTGAG 2 cut(s) 8, 350
BsaAI YACGTR 1 cut(s) 245
BsaBI GATNNNNATC 1 cut(s) 585
BsaJI CCNNGG 1 cut(s) 298
Bsc4I CCNNNNNNNGG 1 cut(s) 117
Bse1I ACTGG 5 cut(s) 54, 164, 520, 611, 692
Bse3DI GCAATG 1 cut(s) 454
Bse8I GATNNNNATC 1 cut(s) 585
BseBI CCWGG 2 cut(s) 300, 434
BseDI CCNNGG 1 cut(s) 298
BseGI GGATG 2 cut(s) 148, 661
BseJI GATNNNNATC 1 cut(s) 585
BseLI CCNNNNNNNGG 1 cut(s) 117
BseMI GCAATG 1 cut(s) 454
BseMII CTCAG 2 cut(s) 43, 126
BseNI ACTGG 5 cut(s) 54, 164, 520, 611, 692
BseSI GKGCMC 1 cut(s) 611
BseXI GCAGC 2 cut(s) 558, 581
BseYI CCCAGC 1 cut(s) 91
BshFI GGCC 2 cut(s) 437, 609
BshNI GGYRCC 1 cut(s) 95
BslI CCNNNNNNNGG 1 cut(s) 117
BsmI GAATGC 1 cut(s) 106
BsnI GGCC 2 cut(s) 437, 609
Bsp120I GGGCCC 1 cut(s) 607
Bsp1286I GDGCHC 1 cut(s) 611
Bsp1407I TGTACA 1 cut(s) 511
Bsp143I GATC 4 cut(s) 268, 484, 562, 586
BspACI CCGC 2 cut(s) 503, 653
BspANI GGCC 2 cut(s) 437, 609
BspCNI CTCAG 2 cut(s) 42, 127
BspHI TCATGA 1 cut(s) 466
BspLI GGNNCC 4 cut(s) 97, 296, 347, 609
BspMAI CTGCAG 2 cut(s) 329, 386
BspPI GGATC 1 cut(s) 570
BspT107I GGYRCC 1 cut(s) 95
BsrDI GCAATG 1 cut(s) 454
BsrGI TGTACA 1 cut(s) 511
BsrI ACTGG 5 cut(s) 54, 164, 520, 611, 692
BssECI CCNNGG 1 cut(s) 298
BssMI GATC 4 cut(s) 268, 484, 562, 586
Bst2UI CCWGG 2 cut(s) 300, 434
Bst4CI ACNGT 1 cut(s) 182
BstAUI TGTACA 1 cut(s) 511
BstBAI YACGTR 1 cut(s) 245
BstDEI CTNAG 2 cut(s) 29, 135
BstF5I GGATG 2 cut(s) 148, 661
BstKTI GATC 4 cut(s) 271, 487, 565, 589
BstMBI GATC 4 cut(s) 268, 484, 562, 586
BstMWI GCNNNNNNNGC 4 cut(s) 448, 552, 575, 674
BstNI CCWGG 2 cut(s) 300, 434
BstNSI RCATGY 1 cut(s) 665
BstSCI CCNGG 2 cut(s) 298, 432
BstSFI CTRYAG 2 cut(s) 325, 382
BstSLI GKGCMC 1 cut(s) 611
BstV1I GCAGC 2 cut(s) 558, 581
BstX2I RGATCY 1 cut(s) 586
BstXI CCANNNNNNTGG 1 cut(s) 527
BstYI RGATCY 1 cut(s) 586
BsuRI GGCC 2 cut(s) 437, 609
BtsCI GGATG 2 cut(s) 148, 661
BtsIMutI CAGTG 1 cut(s) 61
CciI TCATGA 1 cut(s) 466
Cfr13I GGNCC 3 cut(s) 530, 607, 608
Csp6I GTAC 3 cut(s) 96, 240, 512
CviAII CATG 4 cut(s) 401, 467, 488, 662
CviQI GTAC 3 cut(s) 96, 240, 512
DdeI CTNAG 2 cut(s) 29, 135
DpnI GATC 4 cut(s) 270, 486, 564, 588
DpnII GATC 4 cut(s) 268, 484, 562, 586
Eco147I AGGCCT 1 cut(s) 437
Eco24I GRGCYC 1 cut(s) 611
Eco47I GGWCC 1 cut(s) 530
Eco72I CACGTG 1 cut(s) 245
EcoO109I RGGNCCY 1 cut(s) 607
EcoRI GAATTC 1 cut(s) 5
EcoRII CCWGG 2 cut(s) 298, 432
EcoT38I GRGCYC 1 cut(s) 611
FaeI CATG 4 cut(s) 404, 470, 491, 665
FatI CATG 4 cut(s) 400, 466, 487, 661
FbaI TGATCA 2 cut(s) 268, 484
FblI GTMKAC 1 cut(s) 60
Fnu4HI GCNGC 2 cut(s) 547, 570
FokI GGATG 2 cut(s) 155, 668
FriOI GRGCYC 1 cut(s) 611
Fsp4HI GCNGC 2 cut(s) 547, 570
FspBI CTAG 1 cut(s) 590
GluI GCNGC 2 cut(s) 547, 570
GsaI CCCAGC 1 cut(s) 95
HaeIII GGCC 2 cut(s) 437, 609
Hin1II CATG 4 cut(s) 404, 470, 491, 665
HincII GTYRAC 1 cut(s) 85
HindII GTYRAC 1 cut(s) 85
HinfI GANTC 3 cut(s) 211, 218, 470
HphI GGTGA 1 cut(s) 187
Hpy166II GTNNAC 6 cut(s) 61, 85, 178, 242, 305, 530
Hpy188I TCNGA 1 cut(s) 136
Hpy188III TCNNGA 5 cut(s) 215, 272, 467, 482, 590
Hpy8I GTNNAC 6 cut(s) 61, 85, 178, 242, 305, 530
HpyAV CCTTC 2 cut(s) 133, 230
HpyCH4III ACNGT 1 cut(s) 182
HpyCH4IV ACGT 1 cut(s) 244
HpyCH4V TGCA 7 cut(s) 106, 152, 248, 321, 327, 384, 424
HpyF10VI GCNNNNNNNGC 4 cut(s) 448, 552, 575, 674
HpyF3I CTNAG 2 cut(s) 29, 135
HpySE526I ACGT 1 cut(s) 244
Hsp92II CATG 4 cut(s) 404, 470, 491, 665
KpnI GGTACC 1 cut(s) 99
Ksp22I TGATCA 2 cut(s) 268, 484
Kzo9I GATC 4 cut(s) 268, 484, 562, 586
LmnI GCTCC 1 cut(s) 456
Lsp1109I GCAGC 2 cut(s) 558, 581
MaeI CTAG 1 cut(s) 590
MaeII ACGT 1 cut(s) 244
MaeIII GTNAC 1 cut(s) 253
MalI GATC 4 cut(s) 270, 486, 564, 588
MboI GATC 4 cut(s) 268, 484, 562, 586
MboII GAAGA 2 cut(s) 58, 632
MflI RGATCY 1 cut(s) 586
MhlI GDGCHC 1 cut(s) 611
MluCI AATT 4 cut(s) 5, 308, 477, 535
MlyI GAGTC 1 cut(s) 212
MnlI CCTC 3 cut(s) 474, 598, 715
MseI TTAA 3 cut(s) 185, 476, 524
MspR9I CCNGG 2 cut(s) 300, 434
Mva1269I GAATGC 1 cut(s) 106
MvaI CCWGG 2 cut(s) 300, 434
MwoI GCNNNNNNNGC 4 cut(s) 448, 552, 575, 674
NdeII GATC 4 cut(s) 268, 484, 562, 586
NlaIII CATG 4 cut(s) 404, 470, 491, 665
NlaIV GGNNCC 4 cut(s) 97, 296, 347, 609
NspI RCATGY 1 cut(s) 665
PagI TCATGA 1 cut(s) 466
PceI AGGCCT 1 cut(s) 437
PctI GAATGC 1 cut(s) 106
PfeI GAWTC 2 cut(s) 211, 470
PkrI GCNGC 2 cut(s) 548, 571
PleI GAGTC 1 cut(s) 212
PmaCI CACGTG 1 cut(s) 245
PmlI CACGTG 1 cut(s) 245
PpsI GAGTC 1 cut(s) 212
Ppu21I YACGTR 1 cut(s) 245
Psp6I CCWGG 2 cut(s) 298, 432
PspCI CACGTG 1 cut(s) 245
PspFI CCCAGC 1 cut(s) 91
PspGI CCWGG 2 cut(s) 298, 432
PspN4I GGNNCC 4 cut(s) 97, 296, 347, 609
PspOMI GGGCCC 1 cut(s) 607
PspPI GGNCC 3 cut(s) 530, 607, 608
PstI CTGCAG 2 cut(s) 329, 386
PsuI RGATCY 1 cut(s) 586
RsaI GTAC 3 cut(s) 97, 241, 513
RsaNI GTAC 3 cut(s) 96, 240, 512
SaqAI TTAA 3 cut(s) 185, 476, 524
SatI GCNGC 2 cut(s) 547, 570
Sau3AI GATC 4 cut(s) 268, 484, 562, 586
Sau96I GGNCC 3 cut(s) 530, 607, 608
SchI GAGTC 1 cut(s) 212
ScrFI CCNGG 2 cut(s) 300, 434
SduI GDGCHC 1 cut(s) 611
SfcI CTRYAG 2 cut(s) 325, 382
SinI GGWCC 1 cut(s) 530
SmlI CTYRAG 2 cut(s) 23, 365
SmoI CTYRAG 2 cut(s) 23, 365
Sse9I AATT 4 cut(s) 5, 308, 477, 535
SseBI AGGCCT 1 cut(s) 437
SsiI CCGC 2 cut(s) 503, 653
SspMI CTAG 1 cut(s) 590
StuI AGGCCT 1 cut(s) 437
StyD4I CCNGG 2 cut(s) 298, 432
TaaI ACNGT 1 cut(s) 182
TaiI ACGT 1 cut(s) 247
TasI AATT 4 cut(s) 5, 308, 477, 535
TatI WGTACW 1 cut(s) 511
TfiI GAWTC 2 cut(s) 211, 470
Tru1I TTAA 3 cut(s) 185, 476, 524
Tru9I TTAA 3 cut(s) 185, 476, 524
TscAI CASTG 1 cut(s) 61
TseI GCWGC 2 cut(s) 546, 569
TspDTI ATGAA 1 cut(s) 141
TspRI CASTG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 530
XapI RAATTY 1 cut(s) 5
XbaI TCTAGA 1 cut(s) 589
XceI RCATGY 1 cut(s) 665
XmiI GTMKAC 1 cut(s) 60
XspI CTAG 1 cut(s) 590
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.