Rh2BG160200

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Reverse (-)
13835180 .. 13835533
354 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG160200.1

Sequence Viewer

Length: 354 bp
ATGATCGCATGGCCACTATACGCGGAGCAGAAAATGGTTGCTACACTGCTGGTGGAGGAGCTAAAGGTGGCGATTCAACCTAAAGTGTTGCCAACAAAAGCACTAGCAGGGAGGGAGGAGATTGAGATGTTGGTGAGGAAGATTACGGAGCAGAAAGACGGAGATGCAATGAGAGCAAGAGCTAAAGAGCTGAAACCAAGTGGGGAAAAAGCTGTGTGGGTGGATCTTCTTTCAACATGCTGTCTGAATTGTCAAGGCTATGCAAGATCAATACCGAACAGCAGTGCCAGACAGTTGGGACTGATCAAATTCTTGTTTAGGCGGTTGTTCGTGTTGCTAGTCTTCTTTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

117

Amino Acids

13.28

Weight (kDa)

9.3

Isoelectric Point (pI)

41.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 23
AciI CCGC 2 cut(s) 23, 322
AclWI GGATC 1 cut(s) 231
AcoI YGGCCR 1 cut(s) 11
AcsI RAATTY 1 cut(s) 308
AgsI TTSAA 2 cut(s) 77, 234
AluBI AGCT 4 cut(s) 61, 182, 190, 212
AluI AGCT 4 cut(s) 61, 182, 190, 212
AlwI GGATC 1 cut(s) 231
AoxI GGCC 1 cut(s) 11
ApoI RAATTY 1 cut(s) 308
AsuHPI GGTGA 1 cut(s) 145
BalI TGGCCA 1 cut(s) 13
BbsI GAAGAC 1 cut(s) 334
BclI TGATCA 1 cut(s) 303
BfaI CTAG 2 cut(s) 104, 338
BmsI GCATC 1 cut(s) 154
BpiI GAAGAC 1 cut(s) 334
Bse3DI GCAATG 1 cut(s) 174
BseMI GCAATG 1 cut(s) 174
BseRI GAGGAG 2 cut(s) 71, 131
Bsh1236I CGCG 1 cut(s) 23
BshFI GGCC 1 cut(s) 13
BslFI GGGAC 1 cut(s) 312
BsmFI GGGAC 1 cut(s) 312
BsnI GGCC 1 cut(s) 13
Bsp143I GATC 4 cut(s) 3, 223, 266, 303
BspACI CCGC 2 cut(s) 23, 322
BspANI GGCC 1 cut(s) 13
BspFNI CGCG 1 cut(s) 23
BspPI GGATC 1 cut(s) 231
BsrDI GCAATG 1 cut(s) 174
BssMI GATC 4 cut(s) 3, 223, 266, 303
Bst4CI ACNGT 1 cut(s) 294
BstFNI CGCG 1 cut(s) 23
BstKTI GATC 4 cut(s) 6, 226, 269, 306
BstMBI GATC 4 cut(s) 3, 223, 266, 303
BstMWI GCNNNNNNNGC 1 cut(s) 173
BstNSI RCATGY 1 cut(s) 240
BstUI CGCG 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 334
BstX2I RGATCY 1 cut(s) 223
BstXI CCANNNNNNTGG 1 cut(s) 295
BstYI RGATCY 1 cut(s) 223
BsuRI GGCC 1 cut(s) 13
BtsI GCAGTG 2 cut(s) 44, 289
BtsIMutI CAGTG 2 cut(s) 44, 289
CviAII CATG 2 cut(s) 9, 237
CviJI RGCY 6 cut(s) 13, 61, 182, 190, 212, 258
CviKI_1 RGCY 6 cut(s) 13, 61, 182, 190, 212, 258
DpnI GATC 4 cut(s) 5, 225, 268, 305
DpnII GATC 4 cut(s) 3, 223, 266, 303
EaeI YGGCCR 1 cut(s) 11
FaeI CATG 2 cut(s) 12, 240
FaiI YATR 4 cut(s) 10, 19, 238, 261
FaqI GGGAC 1 cut(s) 312
FatI CATG 2 cut(s) 8, 236
FbaI TGATCA 1 cut(s) 303
FspBI CTAG 2 cut(s) 104, 338
HaeIII GGCC 1 cut(s) 13
Hin1II CATG 2 cut(s) 12, 240
HinfI GANTC 1 cut(s) 73
HphI GGTGA 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 246
HpyCH4III ACNGT 1 cut(s) 294
HpyCH4V TGCA 2 cut(s) 167, 263
HpyF10VI GCNNNNNNNGC 1 cut(s) 173
Hsp92II CATG 2 cut(s) 12, 240
Ksp22I TGATCA 1 cut(s) 303
Kzo9I GATC 4 cut(s) 3, 223, 266, 303
LmnI GCTCC 3 cut(s) 25, 58, 148
LpnPI CCDG 3 cut(s) 35, 93, 301
LweI GCATC 1 cut(s) 154
MaeI CTAG 2 cut(s) 104, 338
MalI GATC 4 cut(s) 5, 225, 268, 305
MboI GATC 4 cut(s) 3, 223, 266, 303
MboII GAAGA 3 cut(s) 151, 218, 334
MflI RGATCY 1 cut(s) 223
MlsI TGGCCA 1 cut(s) 13
MluCI AATT 2 cut(s) 247, 308
MluNI TGGCCA 1 cut(s) 13
MnlI CCTC 4 cut(s) 49, 105, 109, 129
Mox20I TGGCCA 1 cut(s) 13
MscI TGGCCA 1 cut(s) 13
Msp20I TGGCCA 1 cut(s) 13
MvnI CGCG 1 cut(s) 23
MwoI GCNNNNNNNGC 1 cut(s) 173
NdeII GATC 4 cut(s) 3, 223, 266, 303
NlaIII CATG 2 cut(s) 12, 240
NspI RCATGY 1 cut(s) 240
PfeI GAWTC 1 cut(s) 73
PsuI RGATCY 1 cut(s) 223
Sau3AI GATC 4 cut(s) 3, 223, 266, 303
SetI ASST 6 cut(s) 63, 69, 82, 184, 192, 214
SfaNI GCATC 1 cut(s) 154
Sse9I AATT 2 cut(s) 247, 308
SsiI CCGC 2 cut(s) 23, 322
SspMI CTAG 2 cut(s) 104, 338
TaaI ACNGT 1 cut(s) 294
TasI AATT 2 cut(s) 247, 308
TfiI GAWTC 1 cut(s) 73
TscAI CASTG 2 cut(s) 51, 289
TspGWI ACGGA 2 cut(s) 161, 174
TspRI CASTG 2 cut(s) 51, 289
XapI RAATTY 1 cut(s) 308
XceI RCATGY 1 cut(s) 240
XspI CTAG 2 cut(s) 104, 338
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.