Rh3BG240400

Belongs to the peptidase C1 family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0003327
Physical Location & Seq
Reverse (-)
22695916 .. 22696299
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG240400.1

Sequence Viewer

Length: 384 bp
ATGTCTATAGCAGAAACCAGCTTGCCACACACAATCATTATGATTCTCTTCTCATCGTCATTGGCCCATGCAAACAACATTGATGTTGCTGAGATCTTCAACCAGTGGATGTGGATCGTCAAACATCAAAGGGTGTACTCTTCCGAGGTTCACAAACAAAACCGTTTTGAGATATTCAAAGTCAACTGGGAGTATATCGAGAACTTCAAGAAGATCGGCAACAAGACCTATACCTTGGGTCTGAATAACTTCTCGGACTTAAGCCCGGAAGAATCCTGGAAACTTATAGTTGCGGCAAAGATCCCACTCCCACCAGTACCCACTCAAACTCGACCTCCACATATCCTCATGTTGGCATGGATTATCTTGACTATGCATGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04140 ko04142 ko04145 ko04210 ko04612 ko05205 ko05323 ko05418 map04140 map04142 map04145 map04210 map04612 map05205 map05323 map05418
Pfam Domains
Protein Families
Inhibitor_I29 Peptidase_C1

Protein Analysis

127

Amino Acids

14.77

Weight (kDa)

8.07

Isoelectric Point (pI)

54.51

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Inhibitor_I29 PF08246 38 - 91 8.5e-17 Cathepsin propeptide inhibitor domain (I29)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 293
AclWI GGATC 2 cut(s) 122, 295
AfaI GTAC 2 cut(s) 137, 318
AfiI CCNNNNNNNGG 1 cut(s) 352
AflII CTTAAG 1 cut(s) 259
AgsI TTSAA 3 cut(s) 100, 178, 208
AjnI CCWGG 1 cut(s) 275
AluBI AGCT 1 cut(s) 21
AluI AGCT 1 cut(s) 21
AlwI GGATC 2 cut(s) 122, 295
AoxI GGCC 1 cut(s) 63
Asp700I GAANNNNTTC 1 cut(s) 248
AspS9I GGNCC 1 cut(s) 64
AsuC2I CCSGG 1 cut(s) 266
BciT130I CCWGG 1 cut(s) 277
BcnI CCSGG 1 cut(s) 266
BfmI CTRYAG 1 cut(s) 6
BfrI CTTAAG 1 cut(s) 259
BglII AGATCT 1 cut(s) 93
BisI GCNGC 1 cut(s) 294
BlsI GCNGC 1 cut(s) 295
Bme1390I CCNGG 2 cut(s) 266, 277
BmgT120I GGNCC 1 cut(s) 64
BmrFI CCNGG 2 cut(s) 266, 277
BmrI ACTGGG 1 cut(s) 196
BmuI ACTGGG 1 cut(s) 196
BpuMI CCSGG 1 cut(s) 266
BsaBI GATNNNNATC 1 cut(s) 113
BsaJI CCNNGG 2 cut(s) 144, 234
BsaXI ACNNNNNCTCC 2 cut(s) 319, 349
Bsc4I CCNNNNNNNGG 1 cut(s) 352
Bse1I ACTGG 3 cut(s) 103, 191, 314
Bse8I GATNNNNATC 1 cut(s) 113
BseBI CCWGG 1 cut(s) 277
BseDI CCNNGG 2 cut(s) 144, 234
BseGI GGATG 1 cut(s) 114
BseJI GATNNNNATC 1 cut(s) 113
BseLI CCNNNNNNNGG 1 cut(s) 352
BseMII CTCAG 1 cut(s) 81
BseNI ACTGG 3 cut(s) 103, 191, 314
BshFI GGCC 1 cut(s) 65
BsiSI CCGG 1 cut(s) 266
BslI CCNNNNNNNGG 1 cut(s) 352
BsnI GGCC 1 cut(s) 65
Bsp143I GATC 4 cut(s) 93, 114, 213, 300
BspACI CCGC 1 cut(s) 293
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 1 cut(s) 82
BspPI GGATC 2 cut(s) 122, 295
BspTI CTTAAG 1 cut(s) 259
BsrI ACTGG 3 cut(s) 103, 191, 314
BssECI CCNNGG 2 cut(s) 144, 234
BssMI GATC 4 cut(s) 93, 114, 213, 300
BssT1I CCWWGG 1 cut(s) 234
Bst2UI CCWGG 1 cut(s) 277
Bst4CI ACNGT 1 cut(s) 164
Bst6I CTCTTC 2 cut(s) 53, 145
BstAFI CTTAAG 1 cut(s) 259
BstC8I GCNNGC 2 cut(s) 23, 378
BstDEI CTNAG 1 cut(s) 90
BstF5I GGATG 1 cut(s) 114
BstKTI GATC 4 cut(s) 96, 117, 216, 303
BstMBI GATC 4 cut(s) 93, 114, 213, 300
BstNI CCWGG 1 cut(s) 277
BstNSI RCATGY 1 cut(s) 380
BstSCI CCNGG 2 cut(s) 264, 275
BstSFI CTRYAG 1 cut(s) 6
BstX2I RGATCY 2 cut(s) 93, 300
BstYI RGATCY 2 cut(s) 93, 300
BsuRI GGCC 1 cut(s) 65
BtsCI GGATG 1 cut(s) 114
BtsIMutI CAGTG 1 cut(s) 110
Cac8I GCNNGC 2 cut(s) 23, 378
Cfr13I GGNCC 1 cut(s) 64
Csp6I GTAC 2 cut(s) 136, 317
CviAII CATG 5 cut(s) 68, 349, 357, 377, 381
CviJI RGCY 3 cut(s) 21, 65, 264
CviKI_1 RGCY 3 cut(s) 21, 65, 264
CviQI GTAC 2 cut(s) 136, 317
DdeI CTNAG 1 cut(s) 90
DpnI GATC 4 cut(s) 95, 116, 215, 302
DpnII GATC 4 cut(s) 93, 114, 213, 300
Eam1104I CTCTTC 2 cut(s) 53, 145
EarI CTCTTC 2 cut(s) 53, 145
Eco130I CCWWGG 1 cut(s) 234
EcoRII CCWGG 1 cut(s) 275
EcoT14I CCWWGG 1 cut(s) 234
EcoT22I ATGCAT 2 cut(s) 378, 382
ErhI CCWWGG 1 cut(s) 234
FaeI CATG 5 cut(s) 71, 352, 360, 380, 384
FatI CATG 5 cut(s) 67, 348, 356, 376, 380
Fnu4HI GCNGC 1 cut(s) 294
FokI GGATG 1 cut(s) 121
Fsp4HI GCNGC 1 cut(s) 294
GluI GCNGC 1 cut(s) 294
HaeIII GGCC 1 cut(s) 65
HapII CCGG 1 cut(s) 266
Hin1II CATG 5 cut(s) 71, 352, 360, 380, 384
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HinfI GANTC 2 cut(s) 43, 272
HpaII CCGG 1 cut(s) 266
Hpy166II GTNNAC 3 cut(s) 136, 151, 184
Hpy188I TCNGA 3 cut(s) 145, 243, 256
Hpy188III TCNNGA 3 cut(s) 199, 208, 367
Hpy8I GTNNAC 3 cut(s) 136, 151, 184
HpyCH4III ACNGT 1 cut(s) 164
HpyCH4V TGCA 3 cut(s) 71, 376, 380
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 5 cut(s) 71, 352, 360, 380, 384
Kzo9I GATC 4 cut(s) 93, 114, 213, 300
LpnPI CCDG 7 cut(s) 31, 116, 172, 262, 279, 289, 327
MalI GATC 4 cut(s) 95, 116, 215, 302
MboI GATC 4 cut(s) 93, 114, 213, 300
MboII GAAGA 5 cut(s) 40, 88, 132, 223, 281
MflI RGATCY 2 cut(s) 93, 300
MnlI CCTC 3 cut(s) 139, 345, 356
Mph1103I ATGCAT 2 cut(s) 378, 382
MroXI GAANNNNTTC 1 cut(s) 248
MseI TTAA 1 cut(s) 260
MspCI CTTAAG 1 cut(s) 259
MspI CCGG 1 cut(s) 266
MspR9I CCNGG 2 cut(s) 266, 277
MvaI CCWGG 1 cut(s) 277
NciI CCSGG 1 cut(s) 266
NdeII GATC 4 cut(s) 93, 114, 213, 300
NlaIII CATG 5 cut(s) 71, 352, 360, 380, 384
NsiI ATGCAT 2 cut(s) 378, 382
NspI RCATGY 1 cut(s) 380
PaeI GCATGC 1 cut(s) 380
PdmI GAANNNNTTC 1 cut(s) 248
PfeI GAWTC 2 cut(s) 43, 272
PfoI TCCNGGA 1 cut(s) 275
PkrI GCNGC 1 cut(s) 295
Psp6I CCWGG 1 cut(s) 275
PspGI CCWGG 1 cut(s) 275
PspPI GGNCC 1 cut(s) 64
PsuI RGATCY 2 cut(s) 93, 300
RsaI GTAC 2 cut(s) 137, 318
RsaNI GTAC 2 cut(s) 136, 317
SaqAI TTAA 1 cut(s) 260
SatI GCNGC 1 cut(s) 294
Sau3AI GATC 4 cut(s) 93, 114, 213, 300
Sau96I GGNCC 1 cut(s) 64
ScrFI CCNGG 2 cut(s) 266, 277
SetI ASST 5 cut(s) 23, 150, 230, 236, 337
SfcI CTRYAG 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 259
SmoI CTYRAG 1 cut(s) 259
SphI GCATGC 1 cut(s) 380
SsiI CCGC 1 cut(s) 293
StyD4I CCNGG 2 cut(s) 264, 275
StyI CCWWGG 1 cut(s) 234
TaaI ACNGT 1 cut(s) 164
TaqI TCGA 2 cut(s) 198, 331
TatI WGTACW 1 cut(s) 135
TauI GCSGC 1 cut(s) 296
TfiI GAWTC 2 cut(s) 43, 272
Tru1I TTAA 1 cut(s) 260
Tru9I TTAA 1 cut(s) 260
TscAI CASTG 1 cut(s) 110
TspRI CASTG 1 cut(s) 110
Vha464I CTTAAG 1 cut(s) 259
XceI RCATGY 1 cut(s) 380
XmnI GAANNNNTTC 1 cut(s) 248
Zsp2I ATGCAT 2 cut(s) 378, 382
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.