Rh3BG354500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
41994965 .. 41998997
4033 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG354500.1

Sequence Viewer

Length: 246 bp
ATGAAAAAGGGCAATGCCCATCCCTCATGGACTTCTACGTACGACAAATACGTGAGAGAGGACAAGCCTTTTGAGGCCATGAGAAGCTTTCGGTATGAGGTTAAGAAAAGTGCTAAACAAGGGCAGATGAAACATAGTTTACTTCCAAAACAATTTAAATGCCGTACCTACATGAAATATGATTTATCGTTTGTTGATAAAACTATAACAAGACATGAGTTAAGATTCACAAAGGAGGAGTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

9.83

Weight (kDa)

9.81

Isoelectric Point (pI)

35.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 2 cut(s) 41, 166
AluBI AGCT 1 cut(s) 87
AluI AGCT 1 cut(s) 87
AoxI GGCC 1 cut(s) 75
ArsI GACNNNNNNTTYG 3 cut(s) 53, 85, 224
BccI CCATC 1 cut(s) 27
BceAI ACGGC 1 cut(s) 147
BsaAI YACGTR 2 cut(s) 39, 52
Bse3DI GCAATG 1 cut(s) 19
BseGI GGATG 1 cut(s) 19
BseMI GCAATG 1 cut(s) 19
BshFI GGCC 1 cut(s) 77
BsiWI CGTACG 1 cut(s) 39
BsnI GGCC 1 cut(s) 77
BspANI GGCC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 19
BstBAI YACGTR 2 cut(s) 39, 52
BstF5I GGATG 1 cut(s) 19
BstSNI TACGTA 1 cut(s) 39
BsuRI GGCC 1 cut(s) 77
BtsCI GGATG 1 cut(s) 19
Csp6I GTAC 2 cut(s) 40, 165
CviAII CATG 4 cut(s) 27, 79, 172, 215
CviJI RGCY 3 cut(s) 67, 77, 87
CviKI_1 RGCY 3 cut(s) 67, 77, 87
CviQI GTAC 2 cut(s) 40, 165
DraI TTTAAA 1 cut(s) 157
Eco105I TACGTA 1 cut(s) 39
FaeI CATG 4 cut(s) 30, 82, 175, 218
FaiI YATR 8 cut(s) 28, 80, 96, 135, 173, 180, 206, 216
FatI CATG 4 cut(s) 26, 78, 171, 214
FokI GGATG 1 cut(s) 6
HaeIII GGCC 1 cut(s) 77
Hin1II CATG 4 cut(s) 30, 82, 175, 218
HindIII AAGCTT 1 cut(s) 85
HinfI GANTC 2 cut(s) 225, 239
Hpy166II GTNNAC 1 cut(s) 140
Hpy8I GTNNAC 1 cut(s) 140
HpyCH4IV ACGT 2 cut(s) 38, 51
HpySE526I ACGT 2 cut(s) 38, 51
Hsp92II CATG 4 cut(s) 30, 82, 175, 218
MaeII ACGT 2 cut(s) 38, 51
MluCI AATT 1 cut(s) 152
MnlI CCTC 5 cut(s) 34, 52, 67, 91, 229
MseI TTAA 3 cut(s) 102, 156, 221
NlaIII CATG 4 cut(s) 30, 82, 175, 218
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PfeI GAWTC 1 cut(s) 225
Pfl23II CGTACG 1 cut(s) 39
Ppu21I YACGTR 2 cut(s) 39, 52
PspLI CGTACG 1 cut(s) 39
RsaI GTAC 2 cut(s) 41, 166
RsaNI GTAC 2 cut(s) 40, 165
SaqAI TTAA 3 cut(s) 102, 156, 221
SetI ASST 5 cut(s) 41, 54, 89, 102, 170
SgeI CNNG 8 cut(s) 39, 64, 76, 91, 131, 184, 222, 227
SmiI ATTTAAAT 1 cut(s) 157
SnaBI TACGTA 1 cut(s) 39
Sse9I AATT 1 cut(s) 152
SwaI ATTTAAAT 1 cut(s) 157
TaiI ACGT 2 cut(s) 41, 54
TasI AATT 1 cut(s) 152
TfiI GAWTC 1 cut(s) 225
Tru1I TTAA 3 cut(s) 102, 156, 221
Tru9I TTAA 3 cut(s) 102, 156, 221
TspDTI ATGAA 3 cut(s) 17, 143, 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.