Rh5BG548500

Belongs to the peroxidase family. Classical plant (class III) peroxidase subfamily

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
87119080 .. 87119358
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG548500.1

Sequence Viewer

Length: 279 bp
ATGGAGACAGGGAGTCCTGACCCGACCTTAAACTCGACCTACATAGAAACCTTGAGTGAGATATGCCCACAGAATGGGAATGGGAGTGTCCTAGCCAATTTTGATCCCTCGACACCTGATGCTTTCGACAGCAACTATTTCCCTAATCTTCCAAGTTCACAGGGTCTACTCAAAGCGACCAAGCGCTGTTCTCTACTAGCGGGGCTAACACCATTGACGTTGTTAACAACTTCACTGTTAATCAGACCGCATTCTTTGAAAGCTTTGTGGAATCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
Pfam Domains
Protein Families

Protein Analysis

92

Amino Acids

9.94

Weight (kDa)

5.59

Isoelectric Point (pI)

44.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
peroxidase PF00141 5 - 59 2.1e-08 Peroxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 74
AccI GTMKAC 1 cut(s) 166
AciI CCGC 2 cut(s) 200, 248
AclWI GGATC 1 cut(s) 98
AfeI AGCGCT 1 cut(s) 185
AfiI CCNNNNNNNGG 1 cut(s) 74
AgsI TTSAA 1 cut(s) 259
AhdI GACNNNNNGTC 1 cut(s) 12
AluBI AGCT 1 cut(s) 263
AluI AGCT 1 cut(s) 263
AlwI GGATC 1 cut(s) 98
Aor51HI AGCGCT 1 cut(s) 185
AspLEI GCGC 1 cut(s) 186
BfaI CTAG 2 cut(s) 92, 197
BfoI RGCGCY 1 cut(s) 187
BmeRI GACNNNNNGTC 1 cut(s) 12
BmsI GCATC 1 cut(s) 109
BpuEI CTTGAG 1 cut(s) 73
Bsa29I ATCGAT 1 cut(s) 274
Bsc4I CCNNNNNNNGG 1 cut(s) 74
BseCI ATCGAT 1 cut(s) 274
BseLI CCNNNNNNNGG 1 cut(s) 74
BshVI ATCGAT 1 cut(s) 274
BslI CCNNNNNNNGG 1 cut(s) 74
BsmI GAATGC 1 cut(s) 250
Bsp143I GATC 1 cut(s) 103
BspACI CCGC 2 cut(s) 200, 248
BspDI ATCGAT 1 cut(s) 274
BspPI GGATC 1 cut(s) 98
BssMI GATC 1 cut(s) 103
Bst4CI ACNGT 1 cut(s) 237
BstH2I RGCGCY 1 cut(s) 187
BstHHI GCGC 1 cut(s) 186
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
Bsu15I ATCGAT 1 cut(s) 274
BsuTUI ATCGAT 1 cut(s) 274
BtsIMutI CAGTG 1 cut(s) 233
CfoI GCGC 1 cut(s) 186
ClaI ATCGAT 1 cut(s) 274
CviJI RGCY 3 cut(s) 95, 205, 263
CviKI_1 RGCY 3 cut(s) 95, 205, 263
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
DriI GACNNNNNGTC 1 cut(s) 12
Eam1105I GACNNNNNGTC 1 cut(s) 12
Eco47III AGCGCT 1 cut(s) 185
FaiI YATR 2 cut(s) 44, 64
FauI CCCGC 1 cut(s) 193
FblI GTMKAC 1 cut(s) 166
FspBI CTAG 2 cut(s) 92, 197
GlaI GCGC 1 cut(s) 185
HaeII RGCGCY 1 cut(s) 187
HhaI GCGC 1 cut(s) 186
Hin6I GCGC 1 cut(s) 184
HinP1I GCGC 1 cut(s) 184
HincII GTYRAC 1 cut(s) 225
HindII GTYRAC 1 cut(s) 225
HindIII AAGCTT 1 cut(s) 261
HinfI GANTC 2 cut(s) 13, 271
HpaI GTTAAC 1 cut(s) 225
Hpy166II GTNNAC 3 cut(s) 158, 167, 225
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 1 cut(s) 17
Hpy8I GTNNAC 3 cut(s) 158, 167, 225
HpyCH4III ACNGT 1 cut(s) 237
HpyCH4IV ACGT 1 cut(s) 218
HpySE526I ACGT 1 cut(s) 218
HspAI GCGC 1 cut(s) 184
KspAI GTTAAC 1 cut(s) 225
Kzo9I GATC 1 cut(s) 103
LpnPI CCDG 3 cut(s) 30, 129, 146
LweI GCATC 1 cut(s) 109
MaeI CTAG 2 cut(s) 92, 197
MaeII ACGT 1 cut(s) 218
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 140
MluCI AATT 1 cut(s) 97
MlyI GAGTC 1 cut(s) 22
MnlI CCTC 1 cut(s) 118
MseI TTAA 3 cut(s) 29, 224, 239
Mva1269I GAATGC 1 cut(s) 250
NdeII GATC 1 cut(s) 103
PctI GAATGC 1 cut(s) 250
PfeI GAWTC 1 cut(s) 271
PflMI CCANNNNNTGG 1 cut(s) 74
PleI GAGTC 1 cut(s) 21
PpsI GAGTC 1 cut(s) 21
SaqAI TTAA 3 cut(s) 29, 224, 239
Sau3AI GATC 1 cut(s) 103
SchI GAGTC 1 cut(s) 22
SetI ASST 6 cut(s) 29, 41, 53, 118, 221, 265
SfaNI GCATC 1 cut(s) 109
SmlI CTYRAG 1 cut(s) 52
SmoI CTYRAG 1 cut(s) 52
Sse9I AATT 1 cut(s) 97
SsiI CCGC 2 cut(s) 200, 248
SspMI CTAG 2 cut(s) 92, 197
TaaI ACNGT 1 cut(s) 237
TaiI ACGT 1 cut(s) 221
TaqI TCGA 4 cut(s) 35, 110, 126, 274
TasI AATT 1 cut(s) 97
TfiI GAWTC 1 cut(s) 271
Tru1I TTAA 3 cut(s) 29, 224, 239
Tru9I TTAA 3 cut(s) 29, 224, 239
TscAI CASTG 1 cut(s) 240
TspRI CASTG 1 cut(s) 240
Van91I CCANNNNNTGG 1 cut(s) 74
XmiI GTMKAC 1 cut(s) 166
XspI CTAG 2 cut(s) 92, 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.