Rh6BG177300

Protein of unknown function (DUF760)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0003449
Physical Location & Seq
Reverse (-)
30123073 .. 30124958
1886 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG177300.1

Sequence Viewer

Length: 480 bp
ATGGATGCACCAGAGTATGCACCTGGTACACAGAAGTCGAATGTGTCAGGGGAAGTTATTAGGTGGAATAATGTTTCTGGCCCTGAGAAAATAGATGCTAAGAAGTACATAGAGTTACTTGAAGCAGAGATTGAGGAATTGAATAATGAAGTTGGTAGGAAATCTGCAAATGGACAAAATGAATTGTTGGAGTATCTCAAGTCTCTCGAGCCCCAAAATTTAAAGGAGTTGACTAGTACTGCTGGAGACGATGTTGTGGTTGCAATGGATACATTCATCAAGCGGCTTTTGGCTGTTTCAGATCCTAGCCAAATGAAGGCTAGTGTAACATCAACAACTGCAGCAGAACTTGCAAAGCTGCTTTATTGGCTAATGGTAGTCGGATATAATCTTCGCAACATTGAAGTTCGTTTTGATATGGAACGAGTACTTGGGAATCCTCCAAAGATCGCAGAATTGCCTCCAGGTGAAAATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF760

Protein Analysis

159

Amino Acids

17.62

Weight (kDa)

4.69

Isoelectric Point (pI)

39.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF760 PF05542 61 - 144 3.8e-21 Protein of unknown function (DUF760)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 283
AclWI GGATC 1 cut(s) 296
AcsI RAATTY 1 cut(s) 217
AfaI GTAC 4 cut(s) 28, 107, 238, 429
AfiI CCNNNNNNNGG 1 cut(s) 316
AgsI TTSAA 3 cut(s) 122, 142, 404
AhlI ACTAGT 1 cut(s) 233
AjnI CCWGG 2 cut(s) 22, 463
AjuI GAANNNNNNNTTGG 2 cut(s) 414, 446
AluBI AGCT 1 cut(s) 358
AluI AGCT 1 cut(s) 358
Alw26I GTCTC 2 cut(s) 207, 240
AlwI GGATC 1 cut(s) 296
Ama87I CYCGRG 1 cut(s) 206
AoxI GGCC 1 cut(s) 79
ApeKI GCWGC 2 cut(s) 341, 358
ApoI RAATTY 1 cut(s) 217
AspS9I GGNCC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 479
AvaI CYCGRG 1 cut(s) 206
BanII GRGCYC 1 cut(s) 213
BbvI GCAGC 2 cut(s) 345, 353
BciT130I CCWGG 2 cut(s) 24, 465
BciVI GTATCC 1 cut(s) 262
BcoDI GTCTC 2 cut(s) 207, 240
BcuI ACTAGT 1 cut(s) 233
BfaI CTAG 3 cut(s) 234, 306, 321
BfmI CTRYAG 1 cut(s) 339
BfuI GTATCC 1 cut(s) 262
BisI GCNGC 3 cut(s) 284, 342, 359
BlsI GCNGC 3 cut(s) 285, 343, 360
BmcAI AGTACT 2 cut(s) 238, 429
Bme1390I CCNGG 2 cut(s) 24, 465
BmeT110I CYCGRG 1 cut(s) 206
BmgT120I GGNCC 1 cut(s) 80
BmrFI CCNGG 2 cut(s) 24, 465
BmsI GCATC 1 cut(s) 85
BpmI CTGGAG 2 cut(s) 264, 447
BpuEI CTTGAG 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 237, 267
Bsc4I CCNNNNNNNGG 1 cut(s) 316
Bse3DI GCAATG 1 cut(s) 270
BseBI CCWGG 2 cut(s) 24, 465
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 316
BseMI GCAATG 1 cut(s) 270
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 2 cut(s) 345, 353
BshFI GGCC 1 cut(s) 81
BsiHKCI CYCGRG 1 cut(s) 206
BslI CCNNNNNNNGG 1 cut(s) 316
BsmAI GTCTC 2 cut(s) 207, 240
BsmBI CGTCTC 1 cut(s) 240
BsnI GGCC 1 cut(s) 81
BsoBI CYCGRG 1 cut(s) 206
Bsp1286I GDGCHC 1 cut(s) 213
Bsp143I GATC 2 cut(s) 301, 447
BspACI CCGC 1 cut(s) 283
BspANI GGCC 1 cut(s) 81
BspCNI CTCAG 1 cut(s) 76
BspMAI CTGCAG 1 cut(s) 343
BspPI GGATC 1 cut(s) 296
BsrDI GCAATG 1 cut(s) 270
BssMI GATC 2 cut(s) 301, 447
Bst2UI CCWGG 2 cut(s) 24, 465
BstAPI GCANNNNNTGC 1 cut(s) 350
BstDEI CTNAG 2 cut(s) 84, 99
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 304, 450
BstMAI GTCTC 2 cut(s) 207, 240
BstMBI GATC 2 cut(s) 301, 447
BstMWI GCNNNNNNNGC 2 cut(s) 350, 367
BstNI CCWGG 2 cut(s) 24, 465
BstSCI CCNGG 2 cut(s) 22, 463
BstSFI CTRYAG 1 cut(s) 339
BstV1I GCAGC 2 cut(s) 345, 353
BstX2I RGATCY 1 cut(s) 301
BstYI RGATCY 1 cut(s) 301
BsuI GTATCC 1 cut(s) 262
BsuRI GGCC 1 cut(s) 81
BtsCI GGATG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 80
CsiI ACCWGGT 1 cut(s) 22
Csp6I GTAC 4 cut(s) 27, 106, 237, 428
CviJI RGCY 8 cut(s) 81, 211, 286, 293, 309, 320, 358, 370
CviKI_1 RGCY 8 cut(s) 81, 211, 286, 293, 309, 320, 358, 370
CviQI GTAC 4 cut(s) 27, 106, 237, 428
DdeI CTNAG 2 cut(s) 84, 99
DpnI GATC 2 cut(s) 303, 449
DpnII GATC 2 cut(s) 301, 447
DraI TTTAAA 1 cut(s) 222
Eco24I GRGCYC 1 cut(s) 213
Eco88I CYCGRG 1 cut(s) 206
EcoRII CCWGG 2 cut(s) 22, 463
EcoT38I GRGCYC 1 cut(s) 213
Esp3I CGTCTC 1 cut(s) 240
FaiI YATR 4 cut(s) 18, 110, 387, 419
Fnu4HI GCNGC 3 cut(s) 284, 342, 359
FokI GGATG 1 cut(s) 17
FriOI GRGCYC 1 cut(s) 213
Fsp4HI GCNGC 3 cut(s) 284, 342, 359
FspBI CTAG 3 cut(s) 234, 306, 321
GluI GCNGC 3 cut(s) 284, 342, 359
GsuI CTGGAG 2 cut(s) 264, 447
HaeIII GGCC 1 cut(s) 81
HincII GTYRAC 1 cut(s) 231
HindII GTYRAC 1 cut(s) 231
HinfI GANTC 1 cut(s) 436
HphI GGTGA 1 cut(s) 479
Hpy166II GTNNAC 2 cut(s) 29, 231
Hpy188I TCNGA 2 cut(s) 301, 383
Hpy188III TCNNGA 1 cut(s) 206
Hpy8I GTNNAC 2 cut(s) 29, 231
HpyAV CCTTC 1 cut(s) 310
HpyCH4V TGCA 6 cut(s) 8, 20, 167, 263, 341, 353
HpyF10VI GCNNNNNNNGC 2 cut(s) 350, 367
HpyF3I CTNAG 2 cut(s) 84, 99
Kzo9I GATC 2 cut(s) 301, 447
LpnPI CCDG 8 cut(s) 9, 24, 33, 36, 63, 96, 228, 450
Lsp1109I GCAGC 2 cut(s) 345, 353
LweI GCATC 1 cut(s) 85
MabI ACCWGGT 1 cut(s) 22
MaeI CTAG 3 cut(s) 234, 306, 321
MaeIII GTNAC 2 cut(s) 114, 325
MalI GATC 2 cut(s) 303, 449
MboI GATC 2 cut(s) 301, 447
MboII GAAGA 1 cut(s) 383
MflI RGATCY 1 cut(s) 301
MhlI GDGCHC 1 cut(s) 213
MluCI AATT 4 cut(s) 137, 182, 217, 455
MmeI TCCRAC 2 cut(s) 168, 361
MnlI CCTC 3 cut(s) 127, 450, 471
MseI TTAA 2 cut(s) 221, 478
MspR9I CCNGG 2 cut(s) 24, 465
MvaI CCWGG 2 cut(s) 24, 465
MwoI GCNNNNNNNGC 2 cut(s) 350, 367
NdeII GATC 2 cut(s) 301, 447
PaeR7I CTCGAG 1 cut(s) 206
PfeI GAWTC 1 cut(s) 436
PkrI GCNGC 3 cut(s) 285, 343, 360
Psp6I CCWGG 2 cut(s) 22, 463
PspGI CCWGG 2 cut(s) 22, 463
PspPI GGNCC 1 cut(s) 80
PstI CTGCAG 1 cut(s) 343
PsuI RGATCY 1 cut(s) 301
RsaI GTAC 4 cut(s) 28, 107, 238, 429
RsaNI GTAC 4 cut(s) 27, 106, 237, 428
SaqAI TTAA 2 cut(s) 221, 478
SatI GCNGC 3 cut(s) 284, 342, 359
Sau3AI GATC 2 cut(s) 301, 447
Sau96I GGNCC 1 cut(s) 80
ScaI AGTACT 2 cut(s) 238, 429
ScrFI CCNGG 2 cut(s) 24, 465
SduI GDGCHC 1 cut(s) 213
SetI ASST 4 cut(s) 25, 65, 360, 469
SexAI ACCWGGT 1 cut(s) 22
SfaNI GCATC 1 cut(s) 85
SfcI CTRYAG 1 cut(s) 339
Sfr274I CTCGAG 1 cut(s) 206
SlaI CTCGAG 1 cut(s) 206
SmlI CTYRAG 2 cut(s) 197, 206
SmoI CTYRAG 2 cut(s) 197, 206
SpeI ACTAGT 1 cut(s) 233
Sse9I AATT 4 cut(s) 137, 182, 217, 455
SsiI CCGC 1 cut(s) 283
SspMI CTAG 3 cut(s) 234, 306, 321
StyD4I CCNGG 2 cut(s) 22, 463
TaqI TCGA 2 cut(s) 38, 207
TasI AATT 4 cut(s) 137, 182, 217, 455
TatI WGTACW 3 cut(s) 105, 236, 427
TauI GCSGC 1 cut(s) 286
TfiI GAWTC 1 cut(s) 436
Tru1I TTAA 2 cut(s) 221, 478
Tru9I TTAA 2 cut(s) 221, 478
TseI GCWGC 2 cut(s) 341, 358
TspDTI ATGAA 4 cut(s) 162, 195, 265, 329
XapI RAATTY 1 cut(s) 217
XhoI CTCGAG 1 cut(s) 206
XspI CTAG 3 cut(s) 234, 306, 321
ZrmI AGTACT 2 cut(s) 238, 429
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.