Rh6CG198900

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0001075
Physical Location & Seq
Forward (+)
33196814 .. 33201825
5012 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG198900.1

Sequence Viewer

Length: 1029 bp
ATGGATGCATCATATGTTAAACCTATTGTGACAGACTTTATCATGATTGGTCCTGGACAAACAATGGATATTTTGATCACGGCCAACCAGCCTCAGGGCACATACTACATGGCCGGTAGACAATATAACACTGTGAGGAAGGATATTTTAGACTATGATAATTCAACTGTGACAGGAATTCTCGAGTATAAAGGCAATTACACACTCTCAACACACCCAATTTTTCCAAGCACCCTACCTACCTTATTTGATTTAGTAGCAGCAAAAAAATTCACAGATCGTCTCAAGAGCCTGGCAACCATAAGCCACCCAGCAGATGTGCCGAAGAATTTAACCACCAGAATGTACTTAATAGCTTCATCTAATTATGGTTTCGTTAATCACTCTGGTCAGTACGAAACTGGCGTAGCTGCTAGTTTGAACAATGTAAGCTGGGCTAACCCATCAACAGATGTGCTACGTGCATACTACAGGAACATGGAAGGATTTTATACCTCAGACTTTCCTAATTTTCCACCATCATTTTATGACTTCGCGTCAGAAGATTATCCTGATACTACGATCATAACTGCCAAAGCAACCAAGGTCAAGGTATTAGAGTACAATGAAGAGGTTGAAATAGTGTTCCAAGGTACTAATGTGCTTGATGCTTCTGAGGATCATCCCATGCACATGCATGGCTATAGCTTTTATGTAGTTGGATCAGGTGCTGGAAATTTTGACAATGAAACAGACCCCAAAGCGTATAATTTGGTTGATCCTCCAAAGATGAATACTGTTTCACTCCCAAAAGTAGGATGGGTTGCTATTAGATTCAAAGCAAGTAATCCTGGGGTTTGGTTTTGGCATTGTCATTTTGATCGACATTTGACTTGGGGTATGAGCTTTGTGATGATAGTCAAAGATGGAGATACACCTGAGACGAGCATACGTAAACCACCCCCAAACATGCCTCCATGTAATGGTTCACCAACCATCAGGCTACAACCTTTTGATATGCTCAGCAAGATAGCAGGTGACACAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

342

Amino Acids

38.3

Weight (kDa)

5.7

Isoelectric Point (pI)

32.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase PF00394 1 - 66 1.5e-11 Multicopper oxidase
Cu-oxidase_2 PF07731 187 - 303 5.1e-40 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 1004
Acc36I ACCTGC 1 cut(s) 1004
AccB7I CCANNNNNTGG 1 cut(s) 962
AccI GTMKAC 1 cut(s) 118
AccII CGCG 1 cut(s) 536
AclWI GGATC 3 cut(s) 666, 709, 752
AcoI YGGCCR 2 cut(s) 81, 111
AcsI RAATTY 4 cut(s) 177, 269, 328, 715
AfaI GTAC 4 cut(s) 347, 395, 602, 634
AfiI CCNNNNNNNGG 3 cut(s) 94, 794, 962
AgsI TTSAA 4 cut(s) 165, 421, 617, 817
AhdI GACNNNNNGTC 1 cut(s) 535
AjnI CCWGG 3 cut(s) 52, 291, 829
AluBI AGCT 5 cut(s) 356, 410, 432, 687, 885
AluI AGCT 5 cut(s) 356, 410, 432, 687, 885
Alw26I GTCTC 2 cut(s) 287, 914
AlwI GGATC 3 cut(s) 666, 709, 752
AlwNI CAGNNNCTG 1 cut(s) 710
Ama87I CYCGRG 1 cut(s) 182
AoxI GGCC 2 cut(s) 81, 111
ApeKI GCWGC 2 cut(s) 260, 410
ApoI RAATTY 4 cut(s) 177, 269, 328, 715
AspS9I GGNCC 1 cut(s) 50
AsuHPI GGTGA 2 cut(s) 960, 1028
AvaI CYCGRG 1 cut(s) 182
AvaII GGWCC 1 cut(s) 50
AxyI CCTNAGG 1 cut(s) 93
BaeGI GKGCMC 1 cut(s) 101
BaeI ACNNNNGTAYC 2 cut(s) 624, 657
BbvI GCAGC 2 cut(s) 272, 397
BccI CCATC 5 cut(s) 451, 526, 792, 899, 983
BceAI ACGGC 1 cut(s) 96
BciT130I CCWGG 3 cut(s) 54, 293, 831
BclI TGATCA 1 cut(s) 75
BcoDI GTCTC 2 cut(s) 287, 914
BfaI CTAG 1 cut(s) 414
BfmI CTRYAG 2 cut(s) 469, 682
BfuAI ACCTGC 1 cut(s) 1004
BisI GCNGC 2 cut(s) 261, 411
BlpI GCTNAGC 1 cut(s) 1001
BlsI GCNGC 2 cut(s) 262, 412
Bme1390I CCNGG 3 cut(s) 54, 293, 831
Bme18I GGWCC 1 cut(s) 50
BmeRI GACNNNNNGTC 1 cut(s) 535
BmeT110I CYCGRG 1 cut(s) 182
BmgT120I GGNCC 1 cut(s) 50
BmrFI CCNGG 3 cut(s) 54, 293, 831
BmsI GCATC 2 cut(s) 17, 637
Bpu1102I GCTNAGC 1 cut(s) 1001
BpuEI CTTGAG 1 cut(s) 269
BsaAI YACGTR 2 cut(s) 461, 932
BsaJI CCNNGG 3 cut(s) 582, 628, 830
Bsc4I CCNNNNNNNGG 3 cut(s) 94, 794, 962
Bse118I RCCGGY 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 406
Bse21I CCTNAGG 1 cut(s) 93
BseBI CCWGG 3 cut(s) 54, 293, 831
BseDI CCNNGG 3 cut(s) 582, 628, 830
BseGI GGATG 3 cut(s) 10, 661, 803
BseLI CCNNNNNNNGG 3 cut(s) 94, 794, 962
BseMII CTCAG 5 cut(s) 107, 510, 645, 909, 1015
BseNI ACTGG 1 cut(s) 406
BseSI GKGCMC 1 cut(s) 101
BseXI GCAGC 2 cut(s) 272, 397
BseYI CCCAGC 2 cut(s) 310, 432
Bsh1236I CGCG 1 cut(s) 536
BshFI GGCC 2 cut(s) 83, 113
BsiHKCI CYCGRG 1 cut(s) 182
BsiSI CCGG 1 cut(s) 114
BslI CCNNNNNNNGG 3 cut(s) 94, 794, 962
BsmAI GTCTC 2 cut(s) 287, 914
BsmBI CGTCTC 2 cut(s) 287, 914
BsnI GGCC 2 cut(s) 83, 113
BsoBI CYCGRG 1 cut(s) 182
Bsp1286I GDGCHC 1 cut(s) 101
Bsp143I GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
Bsp1720I GCTNAGC 1 cut(s) 1001
BspANI GGCC 2 cut(s) 83, 113
BspCNI CTCAG 5 cut(s) 106, 509, 646, 910, 1014
BspFNI CGCG 1 cut(s) 536
BspHI TCATGA 1 cut(s) 42
BspMI ACCTGC 1 cut(s) 1004
BspPI GGATC 3 cut(s) 666, 709, 752
BsrFI RCCGGY 1 cut(s) 113
BsrI ACTGG 1 cut(s) 406
BssAI RCCGGY 1 cut(s) 113
BssECI CCNNGG 3 cut(s) 582, 628, 830
BssMI GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
BssT1I CCWWGG 2 cut(s) 582, 628
Bst2UI CCWGG 3 cut(s) 54, 293, 831
Bst4CI ACNGT 3 cut(s) 133, 169, 778
Bst6I CTCTTC 1 cut(s) 603
BstBAI YACGTR 2 cut(s) 461, 932
BstDEI CTNAG 5 cut(s) 93, 496, 654, 918, 1001
BstF5I GGATG 3 cut(s) 10, 661, 803
BstFNI CGCG 1 cut(s) 536
BstKTI GATC 7 cut(s) 78, 280, 564, 661, 704, 760, 862
BstMAI GTCTC 2 cut(s) 287, 914
BstMBI GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
BstNI CCWGG 3 cut(s) 54, 293, 831
BstNSI RCATGY 2 cut(s) 676, 952
BstSCI CCNGG 3 cut(s) 52, 291, 829
BstSFI CTRYAG 2 cut(s) 469, 682
BstSLI GKGCMC 1 cut(s) 101
BstSNI TACGTA 1 cut(s) 932
BstUI CGCG 1 cut(s) 536
BstV1I GCAGC 2 cut(s) 272, 397
Bsu36I CCTNAGG 1 cut(s) 93
BsuRI GGCC 2 cut(s) 83, 113
BtsCI GGATG 3 cut(s) 10, 661, 803
BtsIMutI CAGTG 1 cut(s) 129
BveI ACCTGC 1 cut(s) 1004
CaiI CAGNNNCTG 1 cut(s) 710
CciI TCATGA 1 cut(s) 42
Cfr10I RCCGGY 1 cut(s) 113
Cfr13I GGNCC 1 cut(s) 50
CseI GACGC 1 cut(s) 525
Csp6I GTAC 4 cut(s) 346, 394, 601, 633
CviAII CATG 8 cut(s) 43, 109, 478, 667, 673, 677, 949, 957
CviQI GTAC 4 cut(s) 346, 394, 601, 633
DdeI CTNAG 5 cut(s) 93, 496, 654, 918, 1001
DpnI GATC 7 cut(s) 77, 279, 563, 660, 703, 759, 861
DpnII GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
DriI GACNNNNNGTC 1 cut(s) 535
EaeI YGGCCR 2 cut(s) 81, 111
Eam1104I CTCTTC 1 cut(s) 603
Eam1105I GACNNNNNGTC 1 cut(s) 535
EarI CTCTTC 1 cut(s) 603
Eco105I TACGTA 1 cut(s) 932
Eco130I CCWWGG 2 cut(s) 582, 628
Eco47I GGWCC 1 cut(s) 50
Eco81I CCTNAGG 1 cut(s) 93
Eco88I CYCGRG 1 cut(s) 182
EcoRI GAATTC 1 cut(s) 177
EcoRII CCWGG 3 cut(s) 52, 291, 829
EcoT14I CCWWGG 2 cut(s) 582, 628
EcoT22I ATGCAT 2 cut(s) 10, 678
ErhI CCWWGG 2 cut(s) 582, 628
Esp3I CGTCTC 2 cut(s) 287, 914
FaeI CATG 8 cut(s) 46, 112, 481, 670, 676, 680, 952, 960
FatI CATG 8 cut(s) 42, 108, 477, 666, 672, 676, 948, 956
FauNDI CATATG 1 cut(s) 13
FbaI TGATCA 1 cut(s) 75
FblI GTMKAC 1 cut(s) 118
Fnu4HI GCNGC 2 cut(s) 261, 411
FokI GGATG 3 cut(s) 17, 648, 810
Fsp4HI GCNGC 2 cut(s) 261, 411
FspBI CTAG 1 cut(s) 414
GluI GCNGC 2 cut(s) 261, 411
GsaI CCCAGC 2 cut(s) 314, 436
HaeIII GGCC 2 cut(s) 83, 113
HapII CCGG 1 cut(s) 114
HgaI GACGC 1 cut(s) 525
Hin1II CATG 8 cut(s) 46, 112, 481, 670, 676, 680, 952, 960
HinfI GANTC 1 cut(s) 813
HpaII CCGG 1 cut(s) 114
HphI GGTGA 2 cut(s) 960, 1028
Hpy166II GTNNAC 3 cut(s) 119, 935, 968
Hpy188I TCNGA 3 cut(s) 499, 541, 655
Hpy188III TCNNGA 4 cut(s) 43, 182, 286, 551
Hpy8I GTNNAC 3 cut(s) 119, 935, 968
HpyAV CCTTC 2 cut(s) 133, 476
HpyCH4III ACNGT 3 cut(s) 133, 169, 778
HpyCH4IV ACGT 2 cut(s) 460, 931
HpyCH4V TGCA 4 cut(s) 8, 464, 670, 676
HpyF3I CTNAG 5 cut(s) 93, 496, 654, 918, 1001
HpySE526I ACGT 2 cut(s) 460, 931
Hsp92II CATG 8 cut(s) 46, 112, 481, 670, 676, 680, 952, 960
Ksp22I TGATCA 1 cut(s) 75
Kzo9I GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
Lsp1109I GCAGC 2 cut(s) 272, 397
LweI GCATC 2 cut(s) 17, 637
MaeI CTAG 1 cut(s) 414
MaeII ACGT 2 cut(s) 460, 931
MaeIII GTNAC 3 cut(s) 28, 169, 1016
MalI GATC 7 cut(s) 77, 279, 563, 660, 703, 759, 861
MboI GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
MboII GAAGA 3 cut(s) 337, 554, 620
MhlI GDGCHC 1 cut(s) 101
MmeI TCCRAC 1 cut(s) 679
MnlI CCTC 7 cut(s) 102, 129, 505, 604, 649, 771, 963
Mph1103I ATGCAT 2 cut(s) 10, 678
MseI TTAA 4 cut(s) 18, 332, 350, 378
MslI CAYNNNNRTG 3 cut(s) 341, 671, 675
MspI CCGG 1 cut(s) 114
MspR9I CCNGG 3 cut(s) 54, 293, 831
MvaI CCWGG 3 cut(s) 54, 293, 831
MvnI CGCG 1 cut(s) 536
NdeI CATATG 1 cut(s) 13
NdeII GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
NlaIII CATG 8 cut(s) 46, 112, 481, 670, 676, 680, 952, 960
NmuCI GTSAC 3 cut(s) 28, 169, 1016
NsiI ATGCAT 2 cut(s) 10, 678
NspI RCATGY 2 cut(s) 676, 952
PaeR7I CTCGAG 1 cut(s) 182
PagI TCATGA 1 cut(s) 42
PaqCI CACCTGC 1 cut(s) 1004
PcsI WCGNNNNNNNCGW 1 cut(s) 402
PfeI GAWTC 1 cut(s) 813
PflMI CCANNNNNTGG 1 cut(s) 962
PfoI TCCNGGA 1 cut(s) 52
PkrI GCNGC 2 cut(s) 262, 412
Ppu21I YACGTR 2 cut(s) 461, 932
Psp6I CCWGG 3 cut(s) 52, 291, 829
PspFI CCCAGC 2 cut(s) 310, 432
PspGI CCWGG 3 cut(s) 52, 291, 829
PspPI GGNCC 1 cut(s) 50
PstNI CAGNNNCTG 1 cut(s) 710
RsaI GTAC 4 cut(s) 347, 395, 602, 634
RsaNI GTAC 4 cut(s) 346, 394, 601, 633
RseI CAYNNNNRTG 3 cut(s) 341, 671, 675
SaqAI TTAA 4 cut(s) 18, 332, 350, 378
SatI GCNGC 2 cut(s) 261, 411
Sau3AI GATC 7 cut(s) 75, 277, 561, 658, 701, 757, 859
Sau96I GGNCC 1 cut(s) 50
ScrFI CCNGG 3 cut(s) 54, 293, 831
SduI GDGCHC 1 cut(s) 101
SfaNI GCATC 2 cut(s) 17, 637
SfcI CTRYAG 2 cut(s) 469, 682
Sfr274I CTCGAG 1 cut(s) 182
SinI GGWCC 1 cut(s) 50
SlaI CTCGAG 1 cut(s) 182
SmiMI CAYNNNNRTG 3 cut(s) 341, 671, 675
SmlI CTYRAG 2 cut(s) 182, 284
SmoI CTYRAG 2 cut(s) 182, 284
SnaBI TACGTA 1 cut(s) 932
SspMI CTAG 1 cut(s) 414
StyD4I CCNGG 3 cut(s) 52, 291, 829
StyI CCWWGG 2 cut(s) 582, 628
TaaI ACNGT 3 cut(s) 133, 169, 778
TaiI ACGT 2 cut(s) 463, 934
TaqI TCGA 2 cut(s) 183, 862
TatI WGTACW 2 cut(s) 345, 600
TfiI GAWTC 1 cut(s) 813
Tru1I TTAA 4 cut(s) 18, 332, 350, 378
Tru9I TTAA 4 cut(s) 18, 332, 350, 378
TscAI CASTG 1 cut(s) 136
TseFI GTSAC 3 cut(s) 28, 169, 1016
TseI GCWGC 2 cut(s) 260, 410
Tsp45I GTSAC 3 cut(s) 28, 169, 1016
TspDTI ATGAA 4 cut(s) 348, 621, 741, 785
TspRI CASTG 1 cut(s) 136
Van91I CCANNNNNTGG 1 cut(s) 962
VpaK11BI GGWCC 1 cut(s) 50
XapI RAATTY 4 cut(s) 177, 269, 328, 715
XceI RCATGY 2 cut(s) 676, 952
XcmI CCANNNNNNNNNTGG 1 cut(s) 795
XhoI CTCGAG 1 cut(s) 182
XmiI GTMKAC 1 cut(s) 118
XspI CTAG 1 cut(s) 414
Zsp2I ATGCAT 2 cut(s) 10, 678
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.