Rh6DG190300

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001075
Physical Location & Seq
Forward (+)
34019426 .. 34023947
4522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG190300.1

Sequence Viewer

Length: 684 bp
ATGTACTTAATAGCTTCATCTAATTATGGTTTCGTTAATCACTCTGGTCAGTACGAAACTGGCGTAGCTGCTAGTTTAAACAATGTAAGCTGGGCTAACCCATCAACAGATGTGTTACGTGCATACTACAGGAACATGGAAGGATTTTATACCTCAGACTTTCCTAATTTTCCACCATCATTTTATGACTTCGCGTCAGAAGATTATCCTGATACTACGATCATAACTGCCAAAGCAACCAAGGTCAAGGTATTAGAGTACAATGAAGAGGTTGAAATAGTGTTCCAAGGTACTAATGTGCTTGATGCTTCTGAGGATCATCCCATGCACATGCATGGCTATAGCTTTTATGTAGTTGGATCAGGTACTGGAAATTTTGACAATGAAACAGACCCCAAAGCGTATAATTTGGTTGATCCTCCAAAGATGAATACTGTTTCACTCCCAAAAGTAGGATGGGTTGCTATTAGATTCAAAGCAAGTAATCCTGGGGTTTGGTTTTGGCATTGTCATTTTGATCGACATTTGACTTGGGGTATGAGCTTTGTGATGATAGTCAAAGATGGAGATACACCTGAGACGAGCATACGTAAACCACCCCCAAACATGCCTCCATGTAATGGTTCACACATCAGGCTACAACCTTTTGATATGCTCAGAAAGATAGCAGGTGACTCAAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

227

Amino Acids

25.63

Weight (kDa)

5.55

Isoelectric Point (pI)

38.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_2 PF07731 70 - 189 2.3e-40 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 659
Acc36I ACCTGC 1 cut(s) 659
AccB7I CCANNNNNTGG 1 cut(s) 620
AccII CGCG 1 cut(s) 194
AclWI GGATC 3 cut(s) 324, 367, 410
AcsI RAATTY 1 cut(s) 373
AfaI GTAC 5 cut(s) 5, 53, 260, 292, 367
AfiI CCNNNNNNNGG 2 cut(s) 452, 620
AgsI TTSAA 2 cut(s) 275, 475
AhdI GACNNNNNGTC 1 cut(s) 193
AjnI CCWGG 1 cut(s) 487
AluBI AGCT 5 cut(s) 14, 68, 90, 345, 543
AluI AGCT 5 cut(s) 14, 68, 90, 345, 543
Alw26I GTCTC 1 cut(s) 572
AlwI GGATC 3 cut(s) 324, 367, 410
AlwNI CAGNNNCTG 1 cut(s) 368
ApeKI GCWGC 1 cut(s) 68
ApoI RAATTY 1 cut(s) 373
AsuHPI GGTGA 1 cut(s) 683
BaeI ACNNNNGTAYC 2 cut(s) 282, 315
BbvI GCAGC 1 cut(s) 55
BccI CCATC 4 cut(s) 109, 184, 450, 557
BciT130I CCWGG 1 cut(s) 489
BcoDI GTCTC 1 cut(s) 572
BfaI CTAG 1 cut(s) 72
BfmI CTRYAG 2 cut(s) 127, 340
BfuAI ACCTGC 1 cut(s) 659
BisI GCNGC 1 cut(s) 69
BlsI GCNGC 1 cut(s) 70
Bme1390I CCNGG 1 cut(s) 489
BmeRI GACNNNNNGTC 1 cut(s) 193
BmrFI CCNGG 1 cut(s) 489
BmsI GCATC 1 cut(s) 295
BsaAI YACGTR 2 cut(s) 119, 590
BsaJI CCNNGG 3 cut(s) 240, 286, 488
Bsc4I CCNNNNNNNGG 2 cut(s) 452, 620
Bse1I ACTGG 2 cut(s) 64, 373
BseBI CCWGG 1 cut(s) 489
BseDI CCNNGG 3 cut(s) 240, 286, 488
BseGI GGATG 2 cut(s) 319, 461
BseLI CCNNNNNNNGG 2 cut(s) 452, 620
BseMII CTCAG 4 cut(s) 168, 303, 567, 670
BseNI ACTGG 2 cut(s) 64, 373
BseXI GCAGC 1 cut(s) 55
BseYI CCCAGC 1 cut(s) 90
Bsh1236I CGCG 1 cut(s) 194
BslI CCNNNNNNNGG 2 cut(s) 452, 620
BsmAI GTCTC 1 cut(s) 572
BsmBI CGTCTC 1 cut(s) 572
Bsp143I GATC 5 cut(s) 219, 316, 359, 415, 517
BspCNI CTCAG 4 cut(s) 167, 304, 568, 669
BspFNI CGCG 1 cut(s) 194
BspMI ACCTGC 1 cut(s) 659
BspPI GGATC 3 cut(s) 324, 367, 410
BsrI ACTGG 2 cut(s) 64, 373
BssECI CCNNGG 3 cut(s) 240, 286, 488
BssMI GATC 5 cut(s) 219, 316, 359, 415, 517
BssT1I CCWWGG 2 cut(s) 240, 286
Bst2UI CCWGG 1 cut(s) 489
Bst4CI ACNGT 1 cut(s) 436
Bst6I CTCTTC 1 cut(s) 261
BstBAI YACGTR 2 cut(s) 119, 590
BstDEI CTNAG 4 cut(s) 154, 312, 576, 656
BstF5I GGATG 2 cut(s) 319, 461
BstFNI CGCG 1 cut(s) 194
BstKTI GATC 5 cut(s) 222, 319, 362, 418, 520
BstMAI GTCTC 1 cut(s) 572
BstMBI GATC 5 cut(s) 219, 316, 359, 415, 517
BstNI CCWGG 1 cut(s) 489
BstNSI RCATGY 2 cut(s) 334, 610
BstSCI CCNGG 1 cut(s) 487
BstSFI CTRYAG 2 cut(s) 127, 340
BstSNI TACGTA 1 cut(s) 590
BstUI CGCG 1 cut(s) 194
BstV1I GCAGC 1 cut(s) 55
BtsCI GGATG 2 cut(s) 319, 461
BveI ACCTGC 1 cut(s) 659
CaiI CAGNNNCTG 1 cut(s) 368
CseI GACGC 1 cut(s) 183
Csp6I GTAC 5 cut(s) 4, 52, 259, 291, 366
CviAII CATG 6 cut(s) 136, 325, 331, 335, 607, 615
CviJI RGCY 8 cut(s) 14, 68, 90, 95, 339, 345, 543, 637
CviKI_1 RGCY 8 cut(s) 14, 68, 90, 95, 339, 345, 543, 637
CviQI GTAC 5 cut(s) 4, 52, 259, 291, 366
DdeI CTNAG 4 cut(s) 154, 312, 576, 656
DpnI GATC 5 cut(s) 221, 318, 361, 417, 519
DpnII GATC 5 cut(s) 219, 316, 359, 415, 517
DraI TTTAAA 1 cut(s) 78
DriI GACNNNNNGTC 1 cut(s) 193
Eam1104I CTCTTC 1 cut(s) 261
Eam1105I GACNNNNNGTC 1 cut(s) 193
EarI CTCTTC 1 cut(s) 261
Eco105I TACGTA 1 cut(s) 590
Eco130I CCWWGG 2 cut(s) 240, 286
EcoRII CCWGG 1 cut(s) 487
EcoT14I CCWWGG 2 cut(s) 240, 286
EcoT22I ATGCAT 1 cut(s) 336
ErhI CCWWGG 2 cut(s) 240, 286
Esp3I CGTCTC 1 cut(s) 572
FaeI CATG 6 cut(s) 139, 328, 334, 338, 610, 618
FatI CATG 6 cut(s) 135, 324, 330, 334, 606, 614
Fnu4HI GCNGC 1 cut(s) 69
FokI GGATG 2 cut(s) 306, 468
Fsp4HI GCNGC 1 cut(s) 69
FspBI CTAG 1 cut(s) 72
GluI GCNGC 1 cut(s) 69
GsaI CCCAGC 1 cut(s) 94
HgaI GACGC 1 cut(s) 183
Hin1II CATG 6 cut(s) 139, 328, 334, 338, 610, 618
HinfI GANTC 2 cut(s) 471, 674
HphI GGTGA 1 cut(s) 683
Hpy166II GTNNAC 2 cut(s) 593, 626
Hpy188I TCNGA 4 cut(s) 157, 199, 313, 659
Hpy188III TCNNGA 1 cut(s) 209
Hpy8I GTNNAC 2 cut(s) 593, 626
HpyAV CCTTC 1 cut(s) 134
HpyCH4III ACNGT 1 cut(s) 436
HpyCH4IV ACGT 2 cut(s) 118, 589
HpyCH4V TGCA 3 cut(s) 122, 328, 334
HpyF3I CTNAG 4 cut(s) 154, 312, 576, 656
HpySE526I ACGT 2 cut(s) 118, 589
Hsp92II CATG 6 cut(s) 139, 328, 334, 338, 610, 618
Kzo9I GATC 5 cut(s) 219, 316, 359, 415, 517
Lsp1109I GCAGC 1 cut(s) 55
LweI GCATC 1 cut(s) 295
MaeI CTAG 1 cut(s) 72
MaeII ACGT 2 cut(s) 118, 589
MaeIII GTNAC 2 cut(s) 114, 671
MalI GATC 5 cut(s) 221, 318, 361, 417, 519
MboI GATC 5 cut(s) 219, 316, 359, 415, 517
MboII GAAGA 2 cut(s) 212, 278
MluCI AATT 4 cut(s) 22, 166, 373, 406
MlyI GAGTC 1 cut(s) 668
MmeI TCCRAC 1 cut(s) 337
MnlI CCTC 5 cut(s) 163, 262, 307, 429, 621
Mph1103I ATGCAT 1 cut(s) 336
MseI TTAA 3 cut(s) 8, 36, 77
MslI CAYNNNNRTG 2 cut(s) 329, 333
MspR9I CCNGG 1 cut(s) 489
MssI GTTTAAAC 1 cut(s) 78
MvaI CCWGG 1 cut(s) 489
MvnI CGCG 1 cut(s) 194
NdeII GATC 5 cut(s) 219, 316, 359, 415, 517
NlaIII CATG 6 cut(s) 139, 328, 334, 338, 610, 618
NmuCI GTSAC 1 cut(s) 671
NsiI ATGCAT 1 cut(s) 336
NspI RCATGY 2 cut(s) 334, 610
PaqCI CACCTGC 1 cut(s) 659
PcsI WCGNNNNNNNCGW 1 cut(s) 60
PfeI GAWTC 1 cut(s) 471
PflMI CCANNNNNTGG 1 cut(s) 620
PkrI GCNGC 1 cut(s) 70
PleI GAGTC 1 cut(s) 668
PmeI GTTTAAAC 1 cut(s) 78
PpsI GAGTC 1 cut(s) 668
Ppu21I YACGTR 2 cut(s) 119, 590
Psp6I CCWGG 1 cut(s) 487
PspFI CCCAGC 1 cut(s) 90
PspGI CCWGG 1 cut(s) 487
PstNI CAGNNNCTG 1 cut(s) 368
RsaI GTAC 5 cut(s) 5, 53, 260, 292, 367
RsaNI GTAC 5 cut(s) 4, 52, 259, 291, 366
RseI CAYNNNNRTG 2 cut(s) 329, 333
SaqAI TTAA 3 cut(s) 8, 36, 77
SatI GCNGC 1 cut(s) 69
Sau3AI GATC 5 cut(s) 219, 316, 359, 415, 517
SchI GAGTC 1 cut(s) 668
ScrFI CCNGG 1 cut(s) 489
SfaNI GCATC 1 cut(s) 295
SfcI CTRYAG 2 cut(s) 127, 340
SmiMI CAYNNNNRTG 2 cut(s) 329, 333
SnaBI TACGTA 1 cut(s) 590
Sse9I AATT 4 cut(s) 22, 166, 373, 406
SspMI CTAG 1 cut(s) 72
StyD4I CCNGG 1 cut(s) 487
StyI CCWWGG 2 cut(s) 240, 286
TaaI ACNGT 1 cut(s) 436
TaiI ACGT 2 cut(s) 121, 592
TaqI TCGA 1 cut(s) 520
TasI AATT 4 cut(s) 22, 166, 373, 406
TatI WGTACW 2 cut(s) 3, 258
TfiI GAWTC 1 cut(s) 471
Tru1I TTAA 3 cut(s) 8, 36, 77
Tru9I TTAA 3 cut(s) 8, 36, 77
TseFI GTSAC 1 cut(s) 671
TseI GCWGC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 671
TspDTI ATGAA 4 cut(s) 6, 279, 399, 443
Van91I CCANNNNNTGG 1 cut(s) 620
XapI RAATTY 1 cut(s) 373
XceI RCATGY 2 cut(s) 334, 610
XcmI CCANNNNNNNNNTGG 1 cut(s) 453
XspI CTAG 1 cut(s) 72
Zsp2I ATGCAT 1 cut(s) 336
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.