Rh7AG313300
ERF Family

Gamma-interferon-inducible lysosomal thiol

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7A
OG0003951
Physical Location & Seq
Forward (+)
35260666 .. 35262366
1701 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7AG313300.1

Sequence Viewer

Length: 591 bp
ATGAAGATTGAAACAAAATATGCAAAGGAAACTGCTCAGCTTAATCCACCACATAGATTTGTGCCGTGGCTGGTTGTCAATAATAAACCACTTGCAGAGGACTACGGAAATTTTATGGCCTATATCTGTAAGGCATACAAAGGAAAATCTCCAGAAGCTTGCAGATCCATTCGCTACAAGACTGAATCAATTGGAAATGAAAAATCGATTCCTCAAAAAGTTATTCTCTCGCTTTACTATGACTCTTTGAGCACATCTTGTGCTACCTTCATCGTCAAGAATCTTGCTAAGATTTTCGATGATGATCTCATCACCATTCTCAATCTCAGACTGGTTCCTTGGGGTGATGCATACGCCAACAAATCGAACAACAGCACCGCTTTCTATCAGAACAAGCACTTTGCTTTGATTTACTGCATAGAATTTTTGGCCATAGAGGGAAGGCACAAGGAGTGGGAAACTTGCTTCAGTTCATTGGGACTGCCTAAGAAACCCACTTTGGATTGCTACAACAGTTCAAATGCAACAAAGGTTCCATATTTAATCCTATCTACAAGGATTCATGATGATTACGTTGTCCATTATGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04612 map04612
Pfam Domains
Protein Families
GILT

Protein Analysis

196

Amino Acids

22.5

Weight (kDa)

8.77

Isoelectric Point (pI)

49.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
GILT PF03227 76 - 126 1e-07 Gamma interferon inducible lysosomal thiol reductase (GILT)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 378
AclWI GGATC 1 cut(s) 159
AcoI YGGCCR 1 cut(s) 429
AcsI RAATTY 2 cut(s) 109, 422
AcuI CTGAAG 1 cut(s) 451
AgsI TTSAA 2 cut(s) 11, 519
AjuI GAANNNNNNNTTGG 2 cut(s) 482, 514
AluBI AGCT 2 cut(s) 40, 158
AluI AGCT 2 cut(s) 40, 158
Alw21I GWGCWC 1 cut(s) 254
AlwI GGATC 1 cut(s) 159
AoxI GGCC 2 cut(s) 117, 429
ApoI RAATTY 2 cut(s) 109, 422
AsuHPI GGTGA 2 cut(s) 304, 356
BalI TGGCCA 1 cut(s) 431
Bbv12I GWGCWC 1 cut(s) 254
BceAI ACGGC 1 cut(s) 49
BlpI GCTNAGC 1 cut(s) 36
BmiI GGNNCC 2 cut(s) 336, 534
BmsI GCATC 1 cut(s) 337
BpmI CTGGAG 1 cut(s) 135
Bpu1102I GCTNAGC 1 cut(s) 36
Bsa29I ATCGAT 1 cut(s) 206
BsaBI GATNNNNATC 1 cut(s) 303
BsaJI CCNNGG 2 cut(s) 65, 338
Bse1I ACTGG 1 cut(s) 336
Bse8I GATNNNNATC 1 cut(s) 303
BseCI ATCGAT 1 cut(s) 206
BseDI CCNNGG 2 cut(s) 65, 338
BseJI GATNNNNATC 1 cut(s) 303
BseMII CTCAG 2 cut(s) 50, 340
BseNI ACTGG 1 cut(s) 336
BshFI GGCC 2 cut(s) 119, 431
BshVI ATCGAT 1 cut(s) 206
BsiHKAI GWGCWC 1 cut(s) 254
BslFI GGGAC 1 cut(s) 492
BsmFI GGGAC 1 cut(s) 492
BsnI GGCC 2 cut(s) 119, 431
Bsp1286I GDGCHC 1 cut(s) 254
Bsp143I GATC 2 cut(s) 164, 304
Bsp1720I GCTNAGC 1 cut(s) 36
BspACI CCGC 1 cut(s) 378
BspANI GGCC 2 cut(s) 119, 431
BspCNI CTCAG 2 cut(s) 49, 339
BspDI ATCGAT 1 cut(s) 206
BspHI TCATGA 1 cut(s) 562
BspLI GGNNCC 2 cut(s) 336, 534
BspPI GGATC 1 cut(s) 159
BsrI ACTGG 1 cut(s) 336
BssECI CCNNGG 2 cut(s) 65, 338
BssMI GATC 2 cut(s) 164, 304
BssT1I CCWWGG 1 cut(s) 338
Bst4CI ACNGT 1 cut(s) 515
BstC8I GCNNGC 1 cut(s) 160
BstDEI CTNAG 4 cut(s) 36, 288, 326, 486
BstDSI CCRYGG 1 cut(s) 65
BstKTI GATC 2 cut(s) 167, 307
BstMBI GATC 2 cut(s) 164, 304
BstX2I RGATCY 1 cut(s) 164
BstYI RGATCY 1 cut(s) 164
Bsu15I ATCGAT 1 cut(s) 206
BsuRI GGCC 2 cut(s) 119, 431
BsuTUI ATCGAT 1 cut(s) 206
BtgI CCRYGG 1 cut(s) 65
Cac8I GCNNGC 1 cut(s) 160
CciI TCATGA 1 cut(s) 562
ClaI ATCGAT 1 cut(s) 206
CviAII CATG 1 cut(s) 563
CviJI RGCY 5 cut(s) 40, 70, 119, 158, 431
CviKI_1 RGCY 5 cut(s) 40, 70, 119, 158, 431
DdeI CTNAG 4 cut(s) 36, 288, 326, 486
DpnI GATC 2 cut(s) 166, 306
DpnII GATC 2 cut(s) 164, 304
EaeI YGGCCR 1 cut(s) 429
Eco130I CCWWGG 1 cut(s) 338
Eco57I CTGAAG 1 cut(s) 451
EcoT14I CCWWGG 1 cut(s) 338
EcoT22I ATGCAT 1 cut(s) 352
ErhI CCWWGG 1 cut(s) 338
FaeI CATG 1 cut(s) 566
FaqI GGGAC 1 cut(s) 492
FatI CATG 1 cut(s) 562
GsuI CTGGAG 1 cut(s) 135
HaeIII GGCC 2 cut(s) 119, 431
Hin1II CATG 1 cut(s) 566
HindIII AAGCTT 1 cut(s) 156
HinfI GANTC 5 cut(s) 185, 208, 242, 280, 559
HphI GGTGA 2 cut(s) 304, 356
Hpy188I TCNGA 2 cut(s) 329, 390
Hpy188III TCNNGA 3 cut(s) 152, 277, 563
HpyAV CCTTC 2 cut(s) 277, 435
HpyCH4III ACNGT 1 cut(s) 515
HpyCH4IV ACGT 1 cut(s) 573
HpyCH4V TGCA 6 cut(s) 23, 95, 162, 350, 417, 524
HpyF3I CTNAG 4 cut(s) 36, 288, 326, 486
HpySE526I ACGT 1 cut(s) 573
Hsp92II CATG 1 cut(s) 566
Kzo9I GATC 2 cut(s) 164, 304
LpnPI CCDG 3 cut(s) 56, 165, 317
LweI GCATC 1 cut(s) 337
MaeII ACGT 1 cut(s) 573
MalI GATC 2 cut(s) 166, 306
MboI GATC 2 cut(s) 164, 304
MboII GAAGA 1 cut(s) 16
MfeI CAATTG 1 cut(s) 189
MflI RGATCY 1 cut(s) 164
MhlI GDGCHC 1 cut(s) 254
MlsI TGGCCA 1 cut(s) 431
MluCI AATT 3 cut(s) 109, 189, 422
MluNI TGGCCA 1 cut(s) 431
MlyI GAGTC 1 cut(s) 236
MnlI CCTC 3 cut(s) 91, 222, 430
Mox20I TGGCCA 1 cut(s) 431
Mph1103I ATGCAT 1 cut(s) 352
MscI TGGCCA 1 cut(s) 431
MseI TTAA 2 cut(s) 42, 542
Msp20I TGGCCA 1 cut(s) 431
MunI CAATTG 1 cut(s) 189
NdeII GATC 2 cut(s) 164, 304
NlaIII CATG 1 cut(s) 566
NlaIV GGNNCC 2 cut(s) 336, 534
NsiI ATGCAT 1 cut(s) 352
PagI TCATGA 1 cut(s) 562
PfeI GAWTC 4 cut(s) 185, 208, 280, 559
PleI GAGTC 1 cut(s) 236
PpsI GAGTC 1 cut(s) 236
PspN4I GGNNCC 2 cut(s) 336, 534
PsuI RGATCY 1 cut(s) 164
SaqAI TTAA 2 cut(s) 42, 542
Sau3AI GATC 2 cut(s) 164, 304
SchI GAGTC 1 cut(s) 236
SduI GDGCHC 1 cut(s) 254
SetI ASST 5 cut(s) 42, 160, 269, 534, 576
SfaNI GCATC 1 cut(s) 337
Sse9I AATT 3 cut(s) 109, 189, 422
SsiI CCGC 1 cut(s) 378
StyI CCWWGG 1 cut(s) 338
TaaI ACNGT 1 cut(s) 515
TaiI ACGT 1 cut(s) 576
TaqI TCGA 3 cut(s) 206, 297, 365
TasI AATT 3 cut(s) 109, 189, 422
TfiI GAWTC 4 cut(s) 185, 208, 280, 559
Tru1I TTAA 2 cut(s) 42, 542
Tru9I TTAA 2 cut(s) 42, 542
TspDTI ATGAA 5 cut(s) 17, 213, 259, 462, 551
TspGWI ACGGA 1 cut(s) 120
XapI RAATTY 2 cut(s) 109, 422
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.