Rh7BG304400

receptor-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
28985716 .. 28986029
314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG304400.1

Sequence Viewer

Length: 207 bp
ATGTTTGACATTATGCTTGAACAAAACTATGGCAATGAAACCATGCACCTCAATCCACCTCTAAAGTTTGTACCATGGTTGGTTCTGAATGATCAACCTATTGGAAATGACTATGAAAATTTTGCTGGCTATGTGTGCAAGGCTTACAAAGGTAACATTGTGCCCATGGCATGTCAGTCTGTACATTTGAAGCAGAAGACAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.85

Weight (kDa)

5.52

Isoelectric Point (pI)

45.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 118
AfaI GTAC 2 cut(s) 72, 183
AgsI TTSAA 2 cut(s) 20, 190
ApoI RAATTY 1 cut(s) 118
BaeGI GKGCMC 1 cut(s) 165
BbsI GAAGAC 1 cut(s) 203
BclI TGATCA 1 cut(s) 91
BpiI GAAGAC 1 cut(s) 203
BsaJI CCNNGG 2 cut(s) 74, 165
Bse3DI GCAATG 1 cut(s) 40
BseDI CCNNGG 2 cut(s) 74, 165
BseMI GCAATG 1 cut(s) 40
BseSI GKGCMC 1 cut(s) 165
Bsp1286I GDGCHC 1 cut(s) 165
Bsp1407I TGTACA 1 cut(s) 181
Bsp143I GATC 1 cut(s) 91
Bsp19I CCATGG 2 cut(s) 74, 165
BsrDI GCAATG 1 cut(s) 40
BsrGI TGTACA 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 74, 165
BssMI GATC 1 cut(s) 91
BssT1I CCWWGG 2 cut(s) 74, 165
BstAUI TGTACA 1 cut(s) 181
BstC8I GCNNGC 1 cut(s) 127
BstDSI CCRYGG 2 cut(s) 74, 165
BstKTI GATC 1 cut(s) 94
BstMBI GATC 1 cut(s) 91
BstMWI GCNNNNNNNGC 1 cut(s) 135
BstNSI RCATGY 1 cut(s) 174
BstSLI GKGCMC 1 cut(s) 165
BstV2I GAAGAC 1 cut(s) 203
BtgI CCRYGG 2 cut(s) 74, 165
Cac8I GCNNGC 1 cut(s) 127
Csp6I GTAC 2 cut(s) 71, 182
CviAII CATG 4 cut(s) 43, 75, 166, 171
CviJI RGCY 2 cut(s) 129, 143
CviKI_1 RGCY 2 cut(s) 129, 143
CviQI GTAC 2 cut(s) 71, 182
DpnI GATC 1 cut(s) 93
DpnII GATC 1 cut(s) 91
Eco130I CCWWGG 2 cut(s) 74, 165
EcoT14I CCWWGG 2 cut(s) 74, 165
ErhI CCWWGG 2 cut(s) 74, 165
FaeI CATG 4 cut(s) 46, 78, 169, 174
FaiI YATR 8 cut(s) 14, 30, 44, 76, 114, 132, 167, 172
FatI CATG 4 cut(s) 42, 74, 165, 170
FbaI TGATCA 1 cut(s) 91
Hin1II CATG 4 cut(s) 46, 78, 169, 174
Hpy188I TCNGA 1 cut(s) 87
HpyCH4V TGCA 2 cut(s) 46, 138
HpyF10VI GCNNNNNNNGC 1 cut(s) 135
Hsp92II CATG 4 cut(s) 46, 78, 169, 174
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 1 cut(s) 91
LpnPI CCDG 1 cut(s) 111
MaeIII GTNAC 1 cut(s) 152
MalI GATC 1 cut(s) 93
MboI GATC 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 165
MluCI AATT 1 cut(s) 118
MnlI CCTC 2 cut(s) 59, 69
MwoI GCNNNNNNNGC 1 cut(s) 135
NcoI CCATGG 2 cut(s) 74, 165
NdeII GATC 1 cut(s) 91
NlaIII CATG 4 cut(s) 46, 78, 169, 174
NspI RCATGY 1 cut(s) 174
RsaI GTAC 2 cut(s) 72, 183
RsaNI GTAC 2 cut(s) 71, 182
Sau3AI GATC 1 cut(s) 91
SduI GDGCHC 1 cut(s) 165
SetI ASST 4 cut(s) 51, 61, 100, 154
SgeI CNNG 7 cut(s) 29, 55, 87, 138, 151, 178, 183
Sse9I AATT 1 cut(s) 118
StyI CCWWGG 2 cut(s) 74, 165
TasI AATT 1 cut(s) 118
TatI WGTACW 1 cut(s) 181
TspDTI ATGAA 2 cut(s) 51, 129
XapI RAATTY 1 cut(s) 118
XceI RCATGY 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.