Rh7BG205200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
17166189 .. 17167687
1499 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG205200.1

Sequence Viewer

Length: 261 bp
ATGTCTTCTGAACGTGTCCAACTCAGTTATCCAAAACCAGAAAGAGTACAAATAGCAGAGGAGGCAGGTGATAATGATGATGGAGAAAAAGAAAAAGATGCCGAGTGTTGGCACGGAGGTCAAAGTATTATGGGGCGAAATGATAATGGGATCATGGAGAGAGTGTCGAAGCTAAGTTCCGCGGTTGGGCTGATTGGTGCAAGGCAGAGAACACAGAGGCTACTTGAATATTTAGAAGATCAGTTGGTTAAAGCTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.65

Weight (kDa)

4.89

Isoelectric Point (pI)

42.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 56
Acc36I ACCTGC 1 cut(s) 56
AccII CGCG 1 cut(s) 182
AciI CCGC 2 cut(s) 180, 182
AclWI GGATC 1 cut(s) 158
AfaI GTAC 1 cut(s) 48
AfiI CCNNNNNNNGG 2 cut(s) 108, 186
AflIII ACRYGT 1 cut(s) 13
AgsI TTSAA 1 cut(s) 227
AluBI AGCT 2 cut(s) 172, 254
AluI AGCT 2 cut(s) 172, 254
AlwI GGATC 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 80
BccI CCATC 1 cut(s) 74
BfuAI ACCTGC 1 cut(s) 56
BmsI GCATC 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 180
BsaXI ACNNNNNCTCC 2 cut(s) 149, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 108, 186
BseDI CCNNGG 1 cut(s) 180
BseLI CCNNNNNNNGG 2 cut(s) 108, 186
BseMII CTCAG 1 cut(s) 37
BseRI GAGGAG 1 cut(s) 74
Bsh1236I CGCG 1 cut(s) 182
BslI CCNNNNNNNGG 2 cut(s) 108, 186
Bsp143I GATC 2 cut(s) 150, 238
BspACI CCGC 2 cut(s) 180, 182
BspCNI CTCAG 1 cut(s) 36
BspFNI CGCG 1 cut(s) 182
BspMI ACCTGC 1 cut(s) 56
BspPI GGATC 1 cut(s) 158
BssECI CCNNGG 1 cut(s) 180
BssMI GATC 2 cut(s) 150, 238
BstDEI CTNAG 2 cut(s) 23, 173
BstDSI CCRYGG 1 cut(s) 180
BstFNI CGCG 1 cut(s) 182
BstKTI GATC 2 cut(s) 153, 241
BstMBI GATC 2 cut(s) 150, 238
BstMWI GCNNNNNNNGC 1 cut(s) 62
BstUI CGCG 1 cut(s) 182
BtgI CCRYGG 1 cut(s) 180
BveI ACCTGC 1 cut(s) 56
Cfr42I CCGCGG 1 cut(s) 183
Csp6I GTAC 1 cut(s) 47
CviAII CATG 1 cut(s) 154
CviJI RGCY 4 cut(s) 172, 190, 220, 254
CviKI_1 RGCY 4 cut(s) 172, 190, 220, 254
CviQI GTAC 1 cut(s) 47
DdeI CTNAG 2 cut(s) 23, 173
DpnI GATC 2 cut(s) 152, 240
DpnII GATC 2 cut(s) 150, 238
FaeI CATG 1 cut(s) 157
FaiI YATR 2 cut(s) 131, 155
FatI CATG 1 cut(s) 153
Hin1II CATG 1 cut(s) 157
HphI GGTGA 1 cut(s) 80
Hpy188I TCNGA 1 cut(s) 10
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 1 cut(s) 200
HpyF10VI GCNNNNNNNGC 1 cut(s) 62
HpyF3I CTNAG 2 cut(s) 23, 173
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 1 cut(s) 157
KspI CCGCGG 1 cut(s) 183
Kzo9I GATC 2 cut(s) 150, 238
LpnPI CCDG 2 cut(s) 51, 51
LweI GCATC 1 cut(s) 88
MaeII ACGT 1 cut(s) 13
MalI GATC 2 cut(s) 152, 240
MboI GATC 2 cut(s) 150, 238
MboII GAAGA 1 cut(s) 248
MmeI TCCRAC 1 cut(s) 43
MnlI CCTC 4 cut(s) 52, 55, 110, 210
MseI TTAA 1 cut(s) 249
MspA1I CMGCKG 1 cut(s) 182
MvnI CGCG 1 cut(s) 182
MwoI GCNNNNNNNGC 1 cut(s) 62
NdeII GATC 2 cut(s) 150, 238
NlaIII CATG 1 cut(s) 157
NmeAIII GCCGAG 1 cut(s) 127
PaqCI CACCTGC 1 cut(s) 56
RsaI GTAC 1 cut(s) 48
RsaNI GTAC 1 cut(s) 47
SacII CCGCGG 1 cut(s) 183
SaqAI TTAA 1 cut(s) 249
Sau3AI GATC 2 cut(s) 150, 238
SetI ASST 5 cut(s) 16, 70, 121, 174, 256
SfaNI GCATC 1 cut(s) 88
Sfr303I CCGCGG 1 cut(s) 183
SgeI CNNG 9 cut(s) 26, 50, 78, 115, 125, 166, 193, 213, 236
SgrBI CCGCGG 1 cut(s) 183
SsiI CCGC 2 cut(s) 180, 182
SspI AATATT 1 cut(s) 230
TaiI ACGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 167
TatI WGTACW 1 cut(s) 46
Tru1I TTAA 1 cut(s) 249
Tru9I TTAA 1 cut(s) 249
TspGWI ACGGA 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.