Rh7CG217400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
19806221 .. 19807610
1390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG217400.1

Sequence Viewer

Length: 213 bp
ATGCCGATGTTGGCTCGCCTGCAAGCAAGCTCAACGAAACAAGTCCAGAGGGCCGGCAGACCTGTTTTGAGTGAGATCAAAGCATTTTATGATGATGATGCGATCATGGGGAGAGTGTTGGAGCTAAGTTCCGCGGTTGGGCTGATTGGTGCAAGGCAGAGAACACAGAGGCTACTTGAATATTTAGAAGATCAGTTGGTTAAAGCTGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.83

Weight (kDa)

8.14

Isoelectric Point (pI)

46.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 134
AciI CCGC 2 cut(s) 132, 134
AfiI CCNNNNNNNGG 1 cut(s) 138
AgsI TTSAA 1 cut(s) 179
AluBI AGCT 3 cut(s) 30, 124, 206
AluI AGCT 3 cut(s) 30, 124, 206
AoxI GGCC 1 cut(s) 51
AspS9I GGNCC 1 cut(s) 51
BmgT120I GGNCC 1 cut(s) 51
BmsI GCATC 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 132
Bsc4I CCNNNNNNNGG 1 cut(s) 138
Bse118I RCCGGY 1 cut(s) 53
BseDI CCNNGG 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 138
Bsh1236I CGCG 1 cut(s) 134
BshFI GGCC 1 cut(s) 53
BsiSI CCGG 1 cut(s) 54
BslI CCNNNNNNNGG 1 cut(s) 138
BsnI GGCC 1 cut(s) 53
Bsp143I GATC 3 cut(s) 75, 102, 190
BspACI CCGC 2 cut(s) 132, 134
BspANI GGCC 1 cut(s) 53
BspFNI CGCG 1 cut(s) 134
BsrFI RCCGGY 1 cut(s) 53
BssAI RCCGGY 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 132
BssMI GATC 3 cut(s) 75, 102, 190
BstC8I GCNNGC 5 cut(s) 16, 20, 24, 28, 55
BstDEI CTNAG 1 cut(s) 125
BstDSI CCRYGG 1 cut(s) 132
BstFNI CGCG 1 cut(s) 134
BstKTI GATC 3 cut(s) 78, 105, 193
BstMBI GATC 3 cut(s) 75, 102, 190
BstUI CGCG 1 cut(s) 134
BsuRI GGCC 1 cut(s) 53
BtgI CCRYGG 1 cut(s) 132
Cac8I GCNNGC 5 cut(s) 16, 20, 24, 28, 55
Cfr10I RCCGGY 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 51
Cfr42I CCGCGG 1 cut(s) 135
CviAII CATG 1 cut(s) 106
CviJI RGCY 7 cut(s) 14, 30, 53, 124, 142, 172, 206
CviKI_1 RGCY 7 cut(s) 14, 30, 53, 124, 142, 172, 206
DdeI CTNAG 1 cut(s) 125
DpnI GATC 3 cut(s) 77, 104, 192
DpnII GATC 3 cut(s) 75, 102, 190
FaeI CATG 1 cut(s) 109
FaiI YATR 2 cut(s) 90, 107
FatI CATG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 53
HapII CCGG 1 cut(s) 54
Hin1II CATG 1 cut(s) 109
HpaII CCGG 1 cut(s) 54
Hpy188III TCNNGA 1 cut(s) 46
HpyCH4V TGCA 2 cut(s) 22, 152
HpyF3I CTNAG 1 cut(s) 125
Hsp92II CATG 1 cut(s) 109
KroI GCCGGC 1 cut(s) 53
KroNI GCCGGC 1 cut(s) 55
KspI CCGCGG 1 cut(s) 135
Kzo9I GATC 3 cut(s) 75, 102, 190
LmnI GCTCC 1 cut(s) 121
LpnPI CCDG 4 cut(s) 32, 59, 67, 75
LweI GCATC 1 cut(s) 88
MalI GATC 3 cut(s) 77, 104, 192
MboI GATC 3 cut(s) 75, 102, 190
MboII GAAGA 1 cut(s) 200
MmeI TCCRAC 1 cut(s) 99
MnlI CCTC 2 cut(s) 42, 162
MroNI GCCGGC 1 cut(s) 53
MseI TTAA 1 cut(s) 201
MspA1I CMGCKG 1 cut(s) 134
MspI CCGG 1 cut(s) 54
MvnI CGCG 1 cut(s) 134
NaeI GCCGGC 1 cut(s) 55
NdeII GATC 3 cut(s) 75, 102, 190
NgoMIV GCCGGC 1 cut(s) 53
NlaIII CATG 1 cut(s) 109
PdiI GCCGGC 1 cut(s) 55
PspPI GGNCC 1 cut(s) 51
SacII CCGCGG 1 cut(s) 135
SaqAI TTAA 1 cut(s) 201
Sau3AI GATC 3 cut(s) 75, 102, 190
Sau96I GGNCC 1 cut(s) 51
SetI ASST 4 cut(s) 32, 64, 126, 208
SfaNI GCATC 1 cut(s) 88
Sfr303I CCGCGG 1 cut(s) 135
SgrBI CCGCGG 1 cut(s) 135
SsiI CCGC 2 cut(s) 132, 134
SspI AATATT 1 cut(s) 182
Tru1I TTAA 1 cut(s) 201
Tru9I TTAA 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.