Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb6

Orthogroup ID

OG0005167

Physical Location & Seq

Genomic Coordinates Forward (+)

37475528 .. 37476253

Gene Structure 726 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_6g50311.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 453 bp

ATGTTGATCACAGATGGACAATTCTCAATGGAATGGCCGCAGATTCAATTACCAGAAGCGGAGATGCGTTATGATCTATATAGCTTGCCTGAAGAAATTGAAAATTTAGTCAACTTGGAAGTATTGAGAGTAAGGCAATGTATTGACGGCTCAGTTAGGAACCTCAAAAAGTTACACGTCCTTGAAATGGTTGGTTGTTGCGACTTTAAGTTGCCTGAAGACATTGGTGAACTGAGCAGTTTAAGAAAGTTGGACATGAGGAATCGCTACGAAGTGAGGAAGCTACCAACATGGATATTGGATCTTGATCAGTTGGAGGAAGTGATCTGCGATGAAGATGGAGCCCTTTTATGGGAAGCCACTCTAACCACTCTCACAAACCTACGCATAGTTGCGATCTCCTTCACCTTGGACACTCTGTTGGACCTAATAAAATTAGTTGGAAAACTATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04626 map04626

Pfam Domains

Protein Families

LRR_8 NB-ARC

Protein Analysis

151

Amino Acids

17.39

Weight (kDa)

4.52

Isoelectric Point (pI)

29.14

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
LRR_14	PF23598	51 - 146	6.7e-09	Leucine-rich repeat region

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005167)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g15150 FvH4_6g50311
malus_domestica	MD02G1164500.v1.1 MD02G1165200.v1.1 MD02G1165700.v1.1 MD15G1263200.v1.1
prunus_persica	Prupe.7G139000_v2.0.a1
pyrus_communis	pycom02g13110 pycom02g13130 pycom15g23970 pycom15g24000
rosa_chinensis	RchiOBHm_Chr2g0104271 RchiOBHm_Chr2g0104291 RchiOBHm_Chr2g0104321 RchiOBHm_Chr2g0104341
rosa_laevigata	RLG00000016962 RLG00000017326
rosa_multiflora	Rmu_co8091214.1_g000001 Rmu_co8203698.1_g000001 Rmu_co8297485.1_g000001 Rmu_co8338119.1_g000001 Rmu_sc0000676.1_g000020 Rmu_sc0002316.1_g000098 Rmu_sc0002414.1_g000006 Rmu_sc0005137.1_g000003
rosa_samantha	Rh2BG177400 Rh2BG178100 Rh2DG176700 Rh2DG177000 Rh7AG022500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	38, 59
AclWI	GGATC	1 cut(s)	309
AcoI	YGGCCR	1 cut(s)	35
AcsI	RAATTY	1 cut(s)	103
AcuI	CTGAAG	2 cut(s)	111, 237
AfiI	CCNNNNNNNGG	3 cut(s)	187, 351, 352
AflIII	ACRYGT	1 cut(s)	175
AgsI	TTSAA	3 cut(s)	47, 101, 185
AjiI	CACGTC	1 cut(s)	178
AluBI	AGCT	2 cut(s)	84, 283
AluI	AGCT	2 cut(s)	84, 283
AlwI	GGATC	1 cut(s)	309
AoxI	GGCC	1 cut(s)	35
ApoI	RAATTY	1 cut(s)	103
AspS9I	GGNCC	1 cut(s)	424
AsuHPI	GGTGA	2 cut(s)	239, 397
AvaII	GGWCC	1 cut(s)	424
BanII	GRGCYC	1 cut(s)	346
BbsI	GAAGAC	1 cut(s)	225
BccI	CCATC	2 cut(s)	8, 332
BceAI	ACGGC	1 cut(s)	163
BclI	TGATCA	2 cut(s)	6, 307
BfmI	CTRYAG	1 cut(s)	449
BisI	GCNGC	1 cut(s)	38
BlsI	GCNGC	1 cut(s)	39
Bme18I	GGWCC	1 cut(s)	424
BmgBI	CACGTC	1 cut(s)	178
BmgT120I	GGNCC	1 cut(s)	424
BmiI	GGNNCC	2 cut(s)	161, 343
BmsI	GCATC	1 cut(s)	54
BpiI	GAAGAC	1 cut(s)	225
BsaBI	GATNNNNATC	1 cut(s)	306
BsaJI	CCNNGG	1 cut(s)	408
Bsc4I	CCNNNNNNNGG	3 cut(s)	187, 351, 352
Bse3DI	GCAATG	1 cut(s)	143
Bse8I	GATNNNNATC	1 cut(s)	306
BseDI	CCNNGG	1 cut(s)	408
BseJI	GATNNNNATC	1 cut(s)	306
BseLI	CCNNNNNNNGG	3 cut(s)	187, 351, 352
BseMI	GCAATG	1 cut(s)	143
BseMII	CTCAG	2 cut(s)	165, 224
BshFI	GGCC	1 cut(s)	37
BslI	CCNNNNNNNGG	3 cut(s)	187, 351, 352
BsnI	GGCC	1 cut(s)	37
Bsp1286I	GDGCHC	1 cut(s)	346
Bsp143I	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
BspACI	CCGC	2 cut(s)	38, 59
BspANI	GGCC	1 cut(s)	37
BspCNI	CTCAG	2 cut(s)	164, 225
BspLI	GGNNCC	2 cut(s)	161, 343
BspPI	GGATC	1 cut(s)	309
BsrDI	GCAATG	1 cut(s)	143
BssECI	CCNNGG	1 cut(s)	408
BssMI	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
BssT1I	CCWWGG	1 cut(s)	408
BstC8I	GCNNGC	1 cut(s)	86
BstDEI	CTNAG	2 cut(s)	151, 233
BstKTI	GATC	6 cut(s)	9, 76, 304, 310, 327, 399
BstMBI	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
BstSFI	CTRYAG	1 cut(s)	449
BstV2I	GAAGAC	1 cut(s)	225
BstX2I	RGATCY	1 cut(s)	301
BstYI	RGATCY	1 cut(s)	301
BsuRI	GGCC	1 cut(s)	37
BtgZI	GCGATG	1 cut(s)	345
BtrI	CACGTC	1 cut(s)	178
Cac8I	GCNNGC	1 cut(s)	86
Cfr13I	GGNCC	1 cut(s)	424
CviAII	CATG	2 cut(s)	256, 291
CviJI	RGCY	6 cut(s)	37, 84, 150, 283, 344, 359
CviKI_1	RGCY	6 cut(s)	37, 84, 150, 283, 344, 359
DdeI	CTNAG	2 cut(s)	151, 233
DpnI	GATC	6 cut(s)	8, 75, 303, 309, 326, 398
DpnII	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
EaeI	YGGCCR	1 cut(s)	35
Eco130I	CCWWGG	1 cut(s)	408
Eco24I	GRGCYC	1 cut(s)	346
Eco47I	GGWCC	1 cut(s)	424
Eco57I	CTGAAG	2 cut(s)	111, 237
EcoT14I	CCWWGG	1 cut(s)	408
EcoT38I	GRGCYC	1 cut(s)	346
ErhI	CCWWGG	1 cut(s)	408
FaeI	CATG	2 cut(s)	259, 294
FaiI	YATR	8 cut(s)	72, 79, 81, 257, 292, 352, 389, 451
FatI	CATG	2 cut(s)	255, 290
FbaI	TGATCA	2 cut(s)	6, 307
Fnu4HI	GCNGC	1 cut(s)	38
FriOI	GRGCYC	1 cut(s)	346
Fsp4HI	GCNGC	1 cut(s)	38
GluI	GCNGC	1 cut(s)	38
HaeIII	GGCC	1 cut(s)	37
Hin1II	CATG	2 cut(s)	259, 294
HincII	GTYRAC	1 cut(s)	112
HindII	GTYRAC	1 cut(s)	112
HinfI	GANTC	2 cut(s)	43, 262
HphI	GGTGA	2 cut(s)	239, 397
Hpy166II	GTNNAC	2 cut(s)	112, 230
Hpy188III	TCNNGA	1 cut(s)	305
Hpy8I	GTNNAC	2 cut(s)	112, 230
HpyAV	CCTTC	1 cut(s)	412
HpyCH4IV	ACGT	1 cut(s)	177
HpyF3I	CTNAG	2 cut(s)	151, 233
HpySE526I	ACGT	1 cut(s)	177
Hsp92II	CATG	2 cut(s)	259, 294
Ksp22I	TGATCA	2 cut(s)	6, 307
Kzo9I	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
LmnI	GCTCC	1 cut(s)	341
LpnPI	CCDG	3 cut(s)	66, 102, 228
LweI	GCATC	1 cut(s)	54
MaeII	ACGT	1 cut(s)	177
MaeIII	GTNAC	1 cut(s)	171
MalI	GATC	6 cut(s)	8, 75, 303, 309, 326, 398
MboI	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
MboII	GAAGA	3 cut(s)	104, 230, 347
MflI	RGATCY	1 cut(s)	301
MhlI	GDGCHC	1 cut(s)	346
MluCI	AATT	5 cut(s)	20, 47, 96, 103, 434
MmeI	TCCRAC	4 cut(s)	231, 294, 402, 421
MnlI	CCTC	4 cut(s)	173, 252, 270, 310
MseI	TTAA	2 cut(s)	207, 242
NdeII	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
NlaIII	CATG	2 cut(s)	259, 294
NlaIV	GGNNCC	2 cut(s)	161, 343
PfeI	GAWTC	2 cut(s)	43, 262
PkrI	GCNGC	1 cut(s)	39
PspN4I	GGNNCC	2 cut(s)	161, 343
PspPI	GGNCC	1 cut(s)	424
PsuI	RGATCY	1 cut(s)	301
SaqAI	TTAA	2 cut(s)	207, 242
SatI	GCNGC	1 cut(s)	38
Sau3AI	GATC	6 cut(s)	6, 73, 301, 307, 324, 396
Sau96I	GGNCC	1 cut(s)	424
SduI	GDGCHC	1 cut(s)	346
SetI	ASST	7 cut(s)	86, 165, 180, 285, 384, 410, 429
SfaNI	GCATC	1 cut(s)	54
SfcI	CTRYAG	1 cut(s)	449
SinI	GGWCC	1 cut(s)	424
Sse9I	AATT	5 cut(s)	20, 47, 96, 103, 434
SsiI	CCGC	2 cut(s)	38, 59
StyI	CCWWGG	1 cut(s)	408
TaiI	ACGT	1 cut(s)	180
TasI	AATT	5 cut(s)	20, 47, 96, 103, 434
TauI	GCSGC	1 cut(s)	40
TfiI	GAWTC	2 cut(s)	43, 262
Tru1I	TTAA	2 cut(s)	207, 242
Tru9I	TTAA	2 cut(s)	207, 242
TspDTI	ATGAA	1 cut(s)	348
VpaK11BI	GGWCC	1 cut(s)	424
XapI	RAATTY	1 cut(s)	103

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.