Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8297485.1

Orthogroup ID

OG0005167

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 549

Gene Structure 549 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8297485.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 549 bp

atggggcaagcttttagcaaaggttccatcaaattttttgaggcattcccagaccttcaagaaatcaacattgactattgcagtgatttggtggaattacctgctgacatctgttttctaatccatctgaaaaagctcagcatcaccaactgtcataagctatctgccttgcctgaaatgattggagagctagtcaatttagaagttttgaggttaaggtcctgcacagacttgtccgagctgccaagttcagttaggaaactcaaaaaactaaaggttcttgacatatccaattgctacagcattaaggagttgcctgaacacattggtgaaatgtgctgcttacaaaagctcaacatgaggcagtgctcgagaatccaagagctgcctgaatcaattttggatcttgaaacgttgactgatgtgatatgtgatgaagagacaaaattgttttgggaaacttactcgccctgtctcagcaaccacatacagataacggcggtcaaagaggaaatcaacctagattggctttatatgcgtcactcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 map04014

Pfam Domains

Protein Families

NB-ARC RPW8

Protein Analysis

182

Amino Acids

20.98

Weight (kDa)

5.05

Isoelectric Point (pI)

56.74

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005167)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g15150 FvH4_6g50311
malus_domestica	MD02G1164500.v1.1 MD02G1165200.v1.1 MD02G1165700.v1.1 MD15G1263200.v1.1
prunus_persica	Prupe.7G139000_v2.0.a1
pyrus_communis	pycom02g13110 pycom02g13130 pycom15g23970 pycom15g24000
rosa_chinensis	RchiOBHm_Chr2g0104271 RchiOBHm_Chr2g0104291 RchiOBHm_Chr2g0104321 RchiOBHm_Chr2g0104341
rosa_laevigata	RLG00000016962 RLG00000017326
rosa_multiflora	Rmu_co8091214.1_g000001 Rmu_co8203698.1_g000001 Rmu_co8297485.1_g000001 Rmu_co8338119.1_g000001 Rmu_sc0000676.1_g000020 Rmu_sc0002316.1_g000098 Rmu_sc0002414.1_g000006 Rmu_sc0005137.1_g000003
rosa_samantha	Rh2BG177400 Rh2BG178100 Rh2DG176700 Rh2DG177000 Rh7AG022500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc36I	ACCTGC	1 cut(s)	109
AciI	CCGC	1 cut(s)	500
AclI	AACGTT	1 cut(s)	413
AclWI	GGATC	1 cut(s)	411
AcsI	RAATTY	1 cut(s)	32
AgsI	TTSAA	2 cut(s)	59, 410
AleI	CACNNNNGTG	1 cut(s)	327
AluBI	AGCT	7 cut(s)	11, 136, 160, 190, 241, 352, 385
AluI	AGCT	7 cut(s)	11, 136, 160, 190, 241, 352, 385
Alw21I	GWGCWC	1 cut(s)	371
Alw26I	GTCTC	2 cut(s)	434, 479
AlwI	GGATC	1 cut(s)	411
Ama87I	CYCGRG	1 cut(s)	370
ApeKI	GCWGC	3 cut(s)	241, 339, 385
ApoI	RAATTY	1 cut(s)	32
AspS9I	GGNCC	1 cut(s)	219
AsuHPI	GGTGA	2 cut(s)	136, 341
AvaI	CYCGRG	1 cut(s)	370
AvaII	GGWCC	1 cut(s)	219
Bbv12I	GWGCWC	1 cut(s)	371
BbvI	GCAGC	3 cut(s)	228, 326, 372
BccI	CCATC	2 cut(s)	35, 132
BceAI	ACGGC	1 cut(s)	513
BcoDI	GTCTC	2 cut(s)	434, 479
BfaI	CTAG	2 cut(s)	191, 521
BfmI	CTRYAG	1 cut(s)	298
BfuAI	ACCTGC	1 cut(s)	109
BisI	GCNGC	3 cut(s)	242, 340, 386
BlpI	GCTNAGC	1 cut(s)	137
BlsI	GCNGC	3 cut(s)	243, 341, 387
Bme18I	GGWCC	1 cut(s)	219
BmeT110I	CYCGRG	1 cut(s)	370
BmgT120I	GGNCC	1 cut(s)	219
BmiI	GGNNCC	1 cut(s)	25
BmsI	GCATC	1 cut(s)	150
Bpu1102I	GCTNAGC	1 cut(s)	137
BsaXI	ACNNNNNCTCC	2 cut(s)	177, 207
BseMII	CTCAG	2 cut(s)	151, 490
BseXI	GCAGC	3 cut(s)	228, 326, 372
BsgI	GTGCAG	1 cut(s)	208
BsiHKAI	GWGCWC	1 cut(s)	371
BsiHKCI	CYCGRG	1 cut(s)	370
BsmAI	GTCTC	2 cut(s)	434, 479
BsmI	GAATGC	1 cut(s)	44
BsoBI	CYCGRG	1 cut(s)	370
Bsp1286I	GDGCHC	1 cut(s)	371
Bsp143I	GATC	1 cut(s)	403
Bsp1720I	GCTNAGC	1 cut(s)	137
BspACI	CCGC	1 cut(s)	500
BspCNI	CTCAG	2 cut(s)	150, 489
BspLI	GGNNCC	1 cut(s)	25
BspMI	ACCTGC	1 cut(s)	109
BspPI	GGATC	1 cut(s)	411
BssMI	GATC	1 cut(s)	403
Bst4CI	ACNGT	1 cut(s)	152
Bst6I	CTCTTC	1 cut(s)	432
BstC8I	GCNNGC	1 cut(s)	9
BstDEI	CTNAG	2 cut(s)	137, 476
BstKTI	GATC	1 cut(s)	406
BstMAI	GTCTC	2 cut(s)	434, 479
BstMBI	GATC	1 cut(s)	403
BstMWI	GCNNNNNNNGC	1 cut(s)	535
BstSFI	CTRYAG	1 cut(s)	298
BstV1I	GCAGC	3 cut(s)	228, 326, 372
BstX2I	RGATCY	1 cut(s)	403
BstYI	RGATCY	1 cut(s)	403
BtsI	GCAGTG	2 cut(s)	88, 371
BtsIMutI	CAGTG	2 cut(s)	88, 371
BveI	ACCTGC	1 cut(s)	109
Cac8I	GCNNGC	1 cut(s)	9
Cfr13I	GGNCC	1 cut(s)	219
CseI	GACGC	1 cut(s)	527
CviAII	CATG	1 cut(s)	358
CviJI	RGCY	8 cut(s)	11, 136, 160, 190, 241, 352, 385, 529
CviKI_1	RGCY	8 cut(s)	11, 136, 160, 190, 241, 352, 385, 529
DdeI	CTNAG	2 cut(s)	137, 476
DpnI	GATC	1 cut(s)	405
DpnII	GATC	1 cut(s)	403
Eam1104I	CTCTTC	1 cut(s)	432
EarI	CTCTTC	1 cut(s)	432
Eco47I	GGWCC	1 cut(s)	219
Eco88I	CYCGRG	1 cut(s)	370
EcoO109I	RGGNCCY	1 cut(s)	219
FaeI	CATG	1 cut(s)	361
FaiI	YATR	7 cut(s)	156, 287, 359, 430, 488, 534, 536
FatI	CATG	1 cut(s)	357
Fnu4HI	GCNGC	3 cut(s)	242, 340, 386
Fsp4HI	GCNGC	3 cut(s)	242, 340, 386
FspBI	CTAG	2 cut(s)	191, 521
GluI	GCNGC	3 cut(s)	242, 340, 386
HgaI	GACGC	1 cut(s)	527
Hin1II	CATG	1 cut(s)	361
HincII	GTYRAC	1 cut(s)	417
HindII	GTYRAC	1 cut(s)	417
HindIII	AAGCTT	1 cut(s)	9
HinfI	GANTC	2 cut(s)	375, 392
HphI	GGTGA	2 cut(s)	136, 341
Hpy166II	GTNNAC	1 cut(s)	417
Hpy188I	TCNGA	2 cut(s)	129, 238
Hpy188III	TCNNGA	5 cut(s)	59, 281, 372, 407, 546
Hpy8I	GTNNAC	1 cut(s)	417
HpyAV	CCTTC	1 cut(s)	65
HpyCH4III	ACNGT	1 cut(s)	152
HpyCH4IV	ACGT	1 cut(s)	413
HpyCH4V	TGCA	2 cut(s)	81, 225
HpyF10VI	GCNNNNNNNGC	1 cut(s)	535
HpyF3I	CTNAG	2 cut(s)	137, 476
HpySE526I	ACGT	1 cut(s)	413
Hsp92II	CATG	1 cut(s)	361
Kzo9I	GATC	1 cut(s)	403
LpnPI	CCDG	7 cut(s)	63, 114, 186, 235, 330, 402, 484
Lsp1109I	GCAGC	3 cut(s)	228, 326, 372
LweI	GCATC	1 cut(s)	150
MaeI	CTAG	2 cut(s)	191, 521
MaeII	ACGT	1 cut(s)	413
MaeIII	GTNAC	1 cut(s)	539
MalI	GATC	1 cut(s)	405
MboI	GATC	1 cut(s)	403
MboII	GAAGA	1 cut(s)	449
MfeI	CAATTG	1 cut(s)	292
MflI	RGATCY	1 cut(s)	403
MhlI	GDGCHC	1 cut(s)	371
MluCI	AATT	6 cut(s)	32, 95, 196, 292, 396, 446
MnlI	CCTC	4 cut(s)	34, 204, 354, 502
MseI	TTAA	2 cut(s)	215, 306
MslI	CAYNNNNRTG	1 cut(s)	327
MunI	CAATTG	1 cut(s)	292
Mva1269I	GAATGC	1 cut(s)	44
MwoI	GCNNNNNNNGC	1 cut(s)	535
NdeII	GATC	1 cut(s)	403
NlaIII	CATG	1 cut(s)	361
NlaIV	GGNNCC	1 cut(s)	25
NmuCI	GTSAC	1 cut(s)	539
OliI	CACNNNNGTG	1 cut(s)	327
PaeR7I	CTCGAG	1 cut(s)	370
PctI	GAATGC	1 cut(s)	44
PfeI	GAWTC	2 cut(s)	375, 392
PkrI	GCNGC	3 cut(s)	243, 341, 387
PpuMI	RGGWCCY	1 cut(s)	219
Psp1406I	AACGTT	1 cut(s)	413
Psp5II	RGGWCCY	1 cut(s)	219
PspN4I	GGNNCC	1 cut(s)	25
PspPI	GGNCC	1 cut(s)	219
PspPPI	RGGWCCY	1 cut(s)	219
PsuI	RGATCY	1 cut(s)	403
RseI	CAYNNNNRTG	1 cut(s)	327
SaqAI	TTAA	2 cut(s)	215, 306
SatI	GCNGC	3 cut(s)	242, 340, 386
Sau3AI	GATC	1 cut(s)	403
Sau96I	GGNCC	1 cut(s)	219
SduI	GDGCHC	1 cut(s)	371
SfaNI	GCATC	1 cut(s)	150
SfcI	CTRYAG	1 cut(s)	298
Sfr274I	CTCGAG	1 cut(s)	370
SinI	GGWCC	1 cut(s)	219
SlaI	CTCGAG	1 cut(s)	370
SmiMI	CAYNNNNRTG	1 cut(s)	327
SmlI	CTYRAG	1 cut(s)	370
SmoI	CTYRAG	1 cut(s)	370
Sse9I	AATT	6 cut(s)	32, 95, 196, 292, 396, 446
SsiI	CCGC	1 cut(s)	500
SspMI	CTAG	2 cut(s)	191, 521
TaaI	ACNGT	1 cut(s)	152
TaiI	ACGT	1 cut(s)	416
TaqI	TCGA	1 cut(s)	371
TasI	AATT	6 cut(s)	32, 95, 196, 292, 396, 446
TfiI	GAWTC	2 cut(s)	375, 392
Tru1I	TTAA	2 cut(s)	215, 306
Tru9I	TTAA	2 cut(s)	215, 306
TscAI	CASTG	2 cut(s)	88, 371
TseFI	GTSAC	1 cut(s)	539
TseI	GCWGC	3 cut(s)	241, 339, 385
Tsp45I	GTSAC	1 cut(s)	539
TspDTI	ATGAA	1 cut(s)	450
TspRI	CASTG	2 cut(s)	88, 371
VpaK11BI	GGWCC	1 cut(s)	219
XapI	RAATTY	1 cut(s)	32
XhoI	CTCGAG	1 cut(s)	370
XspI	CTAG	2 cut(s)	191, 521

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.