Prupe.7G139000_v2.0.a1

Domain of unknown function (DUF4216)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
OG0005167
Physical Location & Seq
Reverse (-)
15514943 .. 15516816
1874 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G139000.1

Sequence Viewer

Length: 492 bp
ATGCCAAATGTTGACACATTTGATGAACTGGTAGATCTTTTTGCAGTACAAAGACGTCGTTTTGTATTTTTTGATGACGTTGTATTGTTTAACAACGACGGTTATTTAGCGTCGTGGTTTATGAGGGAAAAGATGACGGTGGATTCCACGACCATTGAAAAACCAAATACACGACGTAGTGCGAGCTTTGTGATCTCATTTGCCTTAAGGAGCTTAGCATCACCAACTGTCATTAACTTATCCACCTTGCCTGAAAAGATTGGAAAGCTAGTCAGTTTGGAAGTGTTGAGGCTTAGGTCATGTACAGACTTGTTAGAGTTGCCAGGCTCGATTAGGAACCTTAAAAAGTTAAAATTTCTCGACATATCCTATTGCTTTAGCATTAAGGAGTTGCCTGAACACATTGAGACAGAAATTTTATGGGAATCCTTCTTATCCCTACTCGAAAACATACACATAAAGGTGGTCAAAGAAGATATCAACCTAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4216 DUF4218 Transpos_assoc

Protein Analysis

164

Amino Acids

18.87

Weight (kDa)

5.47

Isoelectric Point (pI)

63.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 58
AcsI RAATTY 2 cut(s) 353, 414
AcyI GRCGYC 1 cut(s) 55
AfaI GTAC 2 cut(s) 48, 304
AflII CTTAAG 1 cut(s) 205
AgsI TTSAA 1 cut(s) 158
AjnI CCWGG 1 cut(s) 322
AluBI AGCT 3 cut(s) 186, 213, 268
AluI AGCT 3 cut(s) 186, 213, 268
Alw26I GTCTC 1 cut(s) 401
ApoI RAATTY 2 cut(s) 353, 414
AsuHPI GGTGA 1 cut(s) 213
BciT130I CCWGG 1 cut(s) 324
BcoDI GTCTC 1 cut(s) 401
BfaI CTAG 1 cut(s) 269
BfrI CTTAAG 1 cut(s) 205
BglII AGATCT 1 cut(s) 34
BlpI GCTNAGC 1 cut(s) 214
Bme1390I CCNGG 1 cut(s) 324
BmiI GGNNCC 1 cut(s) 338
BmrFI CCNGG 1 cut(s) 324
BmsI GCATC 1 cut(s) 227
Bpu10I CCTNAGC 1 cut(s) 293
Bpu1102I GCTNAGC 1 cut(s) 214
BsaHI GRCGYC 1 cut(s) 55
Bse1I ACTGG 1 cut(s) 33
BseBI CCWGG 1 cut(s) 324
BseNI ACTGG 1 cut(s) 33
BsmAI GTCTC 1 cut(s) 401
Bsp1407I TGTACA 1 cut(s) 302
Bsp143I GATC 2 cut(s) 34, 192
Bsp1720I GCTNAGC 1 cut(s) 214
BspLI GGNNCC 1 cut(s) 338
BspTI CTTAAG 1 cut(s) 205
BsrGI TGTACA 1 cut(s) 302
BsrI ACTGG 1 cut(s) 33
BssMI GATC 2 cut(s) 34, 192
BssNI GRCGYC 1 cut(s) 55
Bst2UI CCWGG 1 cut(s) 324
Bst4CI ACNGT 3 cut(s) 101, 139, 229
BstACI GRCGYC 1 cut(s) 55
BstAFI CTTAAG 1 cut(s) 205
BstAUI TGTACA 1 cut(s) 302
BstC8I GCNNGC 1 cut(s) 184
BstDEI CTNAG 2 cut(s) 214, 293
BstKTI GATC 2 cut(s) 37, 195
BstMAI GTCTC 1 cut(s) 401
BstMBI GATC 2 cut(s) 34, 192
BstNI CCWGG 1 cut(s) 324
BstSCI CCNGG 1 cut(s) 322
BstX2I RGATCY 1 cut(s) 34
BstYI RGATCY 1 cut(s) 34
Cac8I GCNNGC 1 cut(s) 184
CseI GACGC 1 cut(s) 99
Csp6I GTAC 2 cut(s) 47, 303
CspCI CAANNNNNGTGG 2 cut(s) 136, 171
CviAII CATG 1 cut(s) 300
CviJI RGCY 5 cut(s) 186, 213, 268, 292, 327
CviKI_1 RGCY 5 cut(s) 186, 213, 268, 292, 327
CviQI GTAC 2 cut(s) 47, 303
DdeI CTNAG 2 cut(s) 214, 293
DpnI GATC 2 cut(s) 36, 194
DpnII GATC 2 cut(s) 34, 192
Eco32I GATATC 1 cut(s) 478
EcoRII CCWGG 1 cut(s) 322
EcoRV GATATC 1 cut(s) 478
FaeI CATG 1 cut(s) 303
FaiI YATR 6 cut(s) 122, 301, 365, 421, 452, 458
FatI CATG 1 cut(s) 299
FspBI CTAG 1 cut(s) 269
HgaI GACGC 1 cut(s) 99
Hin1I GRCGYC 1 cut(s) 55
Hin1II CATG 1 cut(s) 303
HincII GTYRAC 1 cut(s) 13
HindII GTYRAC 1 cut(s) 13
HinfI GANTC 2 cut(s) 143, 425
HphI GGTGA 1 cut(s) 213
Hpy166II GTNNAC 1 cut(s) 13
Hpy188III TCNNGA 1 cut(s) 359
Hpy8I GTNNAC 1 cut(s) 13
Hpy99I CGWCG 4 cut(s) 60, 101, 115, 177
HpyAV CCTTC 1 cut(s) 439
HpyCH4III ACNGT 3 cut(s) 101, 139, 229
HpyCH4IV ACGT 3 cut(s) 55, 78, 175
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 2 cut(s) 214, 293
HpySE526I ACGT 3 cut(s) 55, 78, 175
Hsp92I GRCGYC 1 cut(s) 55
Hsp92II CATG 1 cut(s) 303
Kzo9I GATC 2 cut(s) 34, 192
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 5 cut(s) 14, 264, 309, 336, 408
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 269
MaeII ACGT 3 cut(s) 55, 78, 175
MalI GATC 2 cut(s) 36, 194
MboI GATC 2 cut(s) 34, 192
MboII GAAGA 1 cut(s) 485
MflI RGATCY 1 cut(s) 34
MluCI AATT 3 cut(s) 353, 414, 487
MnlI CCTC 2 cut(s) 117, 282
MseI TTAA 6 cut(s) 90, 206, 234, 342, 350, 384
MslI CAYNNNNRTG 1 cut(s) 461
MspCI CTTAAG 1 cut(s) 205
MspR9I CCNGG 1 cut(s) 324
MvaI CCWGG 1 cut(s) 324
NdeII GATC 2 cut(s) 34, 192
NlaIII CATG 1 cut(s) 303
NlaIV GGNNCC 1 cut(s) 338
PfeI GAWTC 2 cut(s) 143, 425
Psp6I CCWGG 1 cut(s) 322
PspGI CCWGG 1 cut(s) 322
PspN4I GGNNCC 1 cut(s) 338
PsuI RGATCY 1 cut(s) 34
RsaI GTAC 2 cut(s) 48, 304
RsaNI GTAC 2 cut(s) 47, 303
RseI CAYNNNNRTG 1 cut(s) 461
SaqAI TTAA 6 cut(s) 90, 206, 234, 342, 350, 384
Sau3AI GATC 2 cut(s) 34, 192
ScrFI CCNGG 1 cut(s) 324
SfaNI GCATC 1 cut(s) 227
SmiMI CAYNNNNRTG 1 cut(s) 461
SmlI CTYRAG 1 cut(s) 205
SmoI CTYRAG 1 cut(s) 205
Sse9I AATT 3 cut(s) 353, 414, 487
SspMI CTAG 1 cut(s) 269
StyD4I CCNGG 1 cut(s) 322
TaaI ACNGT 3 cut(s) 101, 139, 229
TaiI ACGT 3 cut(s) 58, 81, 178
TaqI TCGA 3 cut(s) 329, 360, 444
TasI AATT 3 cut(s) 353, 414, 487
TatI WGTACW 2 cut(s) 46, 302
TfiI GAWTC 2 cut(s) 143, 425
Tru1I TTAA 6 cut(s) 90, 206, 234, 342, 350, 384
Tru9I TTAA 6 cut(s) 90, 206, 234, 342, 350, 384
TspDTI ATGAA 1 cut(s) 39
Vha464I CTTAAG 1 cut(s) 205
XapI RAATTY 2 cut(s) 353, 414
XspI CTAG 1 cut(s) 269
ZraI GACGTC 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.