Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002316.1

Orthogroup ID

OG0005167

Physical Location & Seq

Genomic Coordinates Reverse (-)

433834 .. 434562

Gene Structure 729 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002316.1_g000098.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 729 bp

atgcacaagattcaactttcagatgttgaggttctagttttgaattttcagtcagagaaccatgctttacccaaatttgtggcggacatgaaaaacttgaaggtcctaatagtcacaaataatggttccttgccagctgaattgagtaactttcaactactggattccttgccaaatctgaagagaatcagactagaacgaatttcaattccttccataaccaagaatcgcatacagttgaagagtgtaaagaagatctctttattcatgtgtagcatcggtcaagctttcagcaactcttccttccaaatttcatatgcatttccaaatgtagaggaattgaacattgattgttgcaatgatttggtggaattgtctggcaatctcagtgatctgattgagctaaggaagctcagtatcacccactgtcataagctatctgccttgcctgaaaagataggaaagttgattaaattggtagtgttgaggctaaagtcttgtacggacttggtaacatttccagcctcaattaagaacctcgaaacgttgcagtttctcgacatatctgattgcttcagcatcaaggagttgcctgacgacatcggtgaaatcagcactttagaaaagatcaatatgagacagtgctctagactgaaagatctacctccatcagtttctgatctcgagcgactaaatgaagtgatatgtgatgaggacacaaaagactaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 map04014

Pfam Domains

Protein Families

NB-ARC RPW8

Protein Analysis

242

Amino Acids

27.28

Weight (kDa)

5.88

Isoelectric Point (pI)

35.35

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005167)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g15150 FvH4_6g50311
malus_domestica	MD02G1164500.v1.1 MD02G1165200.v1.1 MD02G1165700.v1.1 MD15G1263200.v1.1
prunus_persica	Prupe.7G139000_v2.0.a1
pyrus_communis	pycom02g13110 pycom02g13130 pycom15g23970 pycom15g24000
rosa_chinensis	RchiOBHm_Chr2g0104271 RchiOBHm_Chr2g0104291 RchiOBHm_Chr2g0104321 RchiOBHm_Chr2g0104341
rosa_laevigata	RLG00000016962 RLG00000017326
rosa_multiflora	Rmu_co8091214.1_g000001 Rmu_co8203698.1_g000001 Rmu_co8297485.1_g000001 Rmu_co8338119.1_g000001 Rmu_sc0000676.1_g000020 Rmu_sc0002316.1_g000098 Rmu_sc0002414.1_g000006 Rmu_sc0005137.1_g000003
rosa_samantha	Rh2BG177400 Rh2BG178100 Rh2DG176700 Rh2DG177000 Rh7AG022500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	83
AclI	AACGTT	1 cut(s)	545
AcsI	RAATTY	4 cut(s)	43, 74, 201, 309
AcuI	CTGAAG	2 cut(s)	200, 559
AfaI	GTAC	1 cut(s)	502
AgsI	TTSAA	7 cut(s)	14, 43, 100, 155, 207, 241, 343
AluBI	AGCT	5 cut(s)	137, 287, 403, 412, 436
AluI	AGCT	5 cut(s)	137, 287, 403, 412, 436
Alw21I	GWGCWC	1 cut(s)	647
Alw26I	GTCTC	1 cut(s)	631
AlwNI	CAGNNNCTG	1 cut(s)	677
Ama87I	CYCGRG	1 cut(s)	683
ApoI	RAATTY	4 cut(s)	43, 74, 201, 309
AspS9I	GGNCC	1 cut(s)	103
AsuHPI	GGTGA	2 cut(s)	412, 617
AvaI	CYCGRG	1 cut(s)	683
AvaII	GGWCC	1 cut(s)	103
Bbv12I	GWGCWC	1 cut(s)	647
BccI	CCATC	1 cut(s)	676
BcoDI	GTCTC	1 cut(s)	631
BfaI	CTAG	3 cut(s)	35, 194, 648
BglII	AGATCT	2 cut(s)	255, 658
Bme18I	GGWCC	1 cut(s)	103
BmeT110I	CYCGRG	1 cut(s)	683
BmgT120I	GGNCC	1 cut(s)	103
BmiI	GGNNCC	1 cut(s)	127
BmsI	GCATC	2 cut(s)	285, 588
Bpu10I	CCTNAGC	1 cut(s)	404
Bse1I	ACTGG	1 cut(s)	165
Bse3DI	GCAATG	1 cut(s)	364
BseMI	GCAATG	1 cut(s)	364
BseMII	CTCAG	2 cut(s)	400, 427
BseNI	ACTGG	1 cut(s)	165
BsiHKAI	GWGCWC	1 cut(s)	647
BsiHKCI	CYCGRG	1 cut(s)	683
BsmAI	GTCTC	1 cut(s)	631
BsoBI	CYCGRG	1 cut(s)	683
Bsp1286I	GDGCHC	1 cut(s)	647
Bsp143I	GATC	5 cut(s)	255, 391, 627, 658, 679
BspACI	CCGC	1 cut(s)	83
BspCNI	CTCAG	2 cut(s)	399, 426
BspLI	GGNNCC	1 cut(s)	127
BsrDI	GCAATG	1 cut(s)	364
BsrI	ACTGG	1 cut(s)	165
BssMI	GATC	5 cut(s)	255, 391, 627, 658, 679
Bst4CI	ACNGT	3 cut(s)	237, 428, 642
Bst6I	CTCTTC	3 cut(s)	176, 236, 304
BstC8I	GCNNGC	1 cut(s)	135
BstDEI	CTNAG	3 cut(s)	386, 404, 413
BstKTI	GATC	5 cut(s)	258, 394, 630, 661, 682
BstMAI	GTCTC	1 cut(s)	631
BstMBI	GATC	5 cut(s)	255, 391, 627, 658, 679
BstMWI	GCNNNNNNNGC	1 cut(s)	409
BstX2I	RGATCY	2 cut(s)	255, 658
BstXI	CCANNNNNNTGG	1 cut(s)	79
BstYI	RGATCY	2 cut(s)	255, 658
BtsIMutI	CAGTG	3 cut(s)	394, 424, 647
Cac8I	GCNNGC	1 cut(s)	135
CaiI	CAGNNNCTG	1 cut(s)	677
Cfr13I	GGNCC	1 cut(s)	103
Csp6I	GTAC	1 cut(s)	501
CviAII	CATG	3 cut(s)	62, 88, 268
CviJI	RGCY	7 cut(s)	137, 287, 403, 412, 436, 490, 524
CviKI_1	RGCY	7 cut(s)	137, 287, 403, 412, 436, 490, 524
CviQI	GTAC	1 cut(s)	501
DdeI	CTNAG	3 cut(s)	386, 404, 413
DpnI	GATC	5 cut(s)	257, 393, 629, 660, 681
DpnII	GATC	5 cut(s)	255, 391, 627, 658, 679
Eam1104I	CTCTTC	3 cut(s)	176, 236, 304
EarI	CTCTTC	3 cut(s)	176, 236, 304
EciI	GGCGGA	1 cut(s)	98
Eco47I	GGWCC	1 cut(s)	103
Eco57I	CTGAAG	2 cut(s)	200, 559
Eco88I	CYCGRG	1 cut(s)	683
EcoO109I	RGGNCCY	1 cut(s)	103
EcoT22I	ATGCAT	1 cut(s)	322
FaeI	CATG	3 cut(s)	65, 91, 271
FatI	CATG	3 cut(s)	61, 87, 267
FauNDI	CATATG	1 cut(s)	316
FspBI	CTAG	3 cut(s)	35, 194, 648
Hin1II	CATG	3 cut(s)	65, 91, 271
HindIII	AAGCTT	1 cut(s)	285
HinfI	GANTC	4 cut(s)	10, 164, 186, 226
HphI	GGTGA	2 cut(s)	412, 617
Hpy188I	TCNGA	7 cut(s)	22, 55, 180, 191, 396, 568, 679
Hpy188III	TCNNGA	3 cut(s)	557, 648, 683
HpyAV	CCTTC	3 cut(s)	94, 222, 313
HpyCH4III	ACNGT	3 cut(s)	237, 428, 642
HpyCH4IV	ACGT	1 cut(s)	545
HpyCH4V	TGCA	4 cut(s)	4, 320, 357, 550
HpyF10VI	GCNNNNNNNGC	1 cut(s)	409
HpyF3I	CTNAG	3 cut(s)	386, 404, 413
HpySE526I	ACGT	1 cut(s)	545
Hsp92II	CATG	3 cut(s)	65, 91, 271
Kzo9I	GATC	5 cut(s)	255, 391, 627, 658, 679
LpnPI	CCDG	6 cut(s)	146, 147, 363, 462, 534, 606
LweI	GCATC	2 cut(s)	285, 588
MaeI	CTAG	3 cut(s)	35, 194, 648
MaeII	ACGT	1 cut(s)	545
MaeIII	GTNAC	3 cut(s)	112, 146, 511
MalI	GATC	5 cut(s)	257, 393, 629, 660, 681
MboI	GATC	5 cut(s)	255, 391, 627, 658, 679
MboII	GAAGA	4 cut(s)	193, 253, 265, 291
MflI	RGATCY	2 cut(s)	255, 658
MhlI	GDGCHC	1 cut(s)	647
MnlI	CCTC	7 cut(s)	22, 328, 480, 535, 548, 675, 706
Mph1103I	ATGCAT	1 cut(s)	322
MseI	TTAA	2 cut(s)	471, 531
MspA1I	CMGCKG	1 cut(s)	137
MwoI	GCNNNNNNNGC	1 cut(s)	409
NdeI	CATATG	1 cut(s)	316
NdeII	GATC	5 cut(s)	255, 391, 627, 658, 679
NlaIII	CATG	3 cut(s)	65, 91, 271
NlaIV	GGNNCC	1 cut(s)	127
NmuCI	GTSAC	1 cut(s)	112
NsiI	ATGCAT	1 cut(s)	322
PaeR7I	CTCGAG	1 cut(s)	683
PfeI	GAWTC	4 cut(s)	10, 164, 186, 226
PpuMI	RGGWCCY	1 cut(s)	103
Psp1406I	AACGTT	1 cut(s)	545
Psp5II	RGGWCCY	1 cut(s)	103
PspN4I	GGNNCC	1 cut(s)	127
PspPI	GGNCC	1 cut(s)	103
PspPPI	RGGWCCY	1 cut(s)	103
PstNI	CAGNNNCTG	1 cut(s)	677
PsuI	RGATCY	2 cut(s)	255, 658
PvuII	CAGCTG	1 cut(s)	137
RsaI	GTAC	1 cut(s)	502
RsaNI	GTAC	1 cut(s)	501
SaqAI	TTAA	2 cut(s)	471, 531
Sau3AI	GATC	5 cut(s)	255, 391, 627, 658, 679
Sau96I	GGNCC	1 cut(s)	103
SduI	GDGCHC	1 cut(s)	647
SfaNI	GCATC	2 cut(s)	285, 588
Sfr274I	CTCGAG	1 cut(s)	683
SinI	GGWCC	1 cut(s)	103
SlaI	CTCGAG	1 cut(s)	683
SmlI	CTYRAG	1 cut(s)	683
SmoI	CTYRAG	1 cut(s)	683
SsiI	CCGC	1 cut(s)	83
SspMI	CTAG	3 cut(s)	35, 194, 648
TaaI	ACNGT	3 cut(s)	237, 428, 642
TaiI	ACGT	1 cut(s)	548
TaqI	TCGA	3 cut(s)	540, 558, 684
TaqII	GACCGA	1 cut(s)	269
TfiI	GAWTC	4 cut(s)	10, 164, 186, 226
Tru1I	TTAA	2 cut(s)	471, 531
Tru9I	TTAA	2 cut(s)	471, 531
TscAI	CASTG	3 cut(s)	394, 431, 647
TseFI	GTSAC	1 cut(s)	112
Tsp45I	GTSAC	1 cut(s)	112
TspDTI	ATGAA	4 cut(s)	104, 256, 303, 711
TspGWI	ACGGA	1 cut(s)	518
TspRI	CASTG	3 cut(s)	394, 431, 647
VpaK11BI	GGWCC	1 cut(s)	103
XapI	RAATTY	4 cut(s)	43, 74, 201, 309
XbaI	TCTAGA	1 cut(s)	647
XhoI	CTCGAG	1 cut(s)	683
XspI	CTAG	3 cut(s)	35, 194, 648
Zsp2I	ATGCAT	1 cut(s)	322

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.