Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002414.1

Orthogroup ID

OG0005167

Physical Location & Seq

Genomic Coordinates Forward (+)

8123 .. 10038

Gene Structure 1916 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002414.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 741 bp

atgtcggctgcatttccaaacctagagaaaatggatattcaagagtgcagatttttgggaaacttgttttcagagctttgtgatctgattcagctaaagaaacccggtatcattgaccattctgatgtagaagctttgcctaaagaaattagaaatttggtcaactcagaagtactgaggttaaggtcttgttataaccttttgaagttaccaagctcagttagaaatctcgaaaagttaaaacctcttgacatatttaacggcatcaacttcaaggaattgcctccatcaattggtgaattgagcagtttaagaaagttgaacaaaatgaaaagtttaagaaagttgaacaaaatgaaagaactacctctgtcagttttgtatcggttaaaggaagcagtgatatgtgatgacgctaccaaaacctttatcggatctggcagcggcagtcttagaccacaagatcgctctcgtccggtggctacccaggcatcttgggtagcctttggcctcgccaacgccgtgcggtctgctgccggacggggatgcaagctaacgttttggggagctcctattgagtggtcttgcttgaggtgtttgcagatcggggtgtgtcgtggtgatgctgggtgtggcggcgtggttcagggtgatttgggatgtggtgattggttcatagcggcgggatcatggcagagcaggcatggcgttgggatctgttcgatggttaggcgtgtgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04014 map04014

Pfam Domains

Protein Families

NB-ARC RPW8

Protein Analysis

246

Amino Acids

27.1

Weight (kDa)

9.34

Isoelectric Point (pI)

51.29

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005167)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g15150 FvH4_6g50311
malus_domestica	MD02G1164500.v1.1 MD02G1165200.v1.1 MD02G1165700.v1.1 MD15G1263200.v1.1
prunus_persica	Prupe.7G139000_v2.0.a1
pyrus_communis	pycom02g13110 pycom02g13130 pycom15g23970 pycom15g24000
rosa_chinensis	RchiOBHm_Chr2g0104271 RchiOBHm_Chr2g0104291 RchiOBHm_Chr2g0104321 RchiOBHm_Chr2g0104341
rosa_laevigata	RLG00000016962 RLG00000017326
rosa_multiflora	Rmu_co8091214.1_g000001 Rmu_co8203698.1_g000001 Rmu_co8297485.1_g000001 Rmu_co8338119.1_g000001 Rmu_sc0000676.1_g000020 Rmu_sc0002316.1_g000098 Rmu_sc0002414.1_g000006 Rmu_sc0005137.1_g000003
rosa_samantha	Rh2BG177400 Rh2BG178100 Rh2DG176700 Rh2DG177000 Rh7AG022500

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	195
AccB7I	CCANNNNNTGG	1 cut(s)	293
AciI	CCGC	5 cut(s)	444, 526, 636, 680, 683
AclI	AACGTT	1 cut(s)	557
AclWI	GGATC	3 cut(s)	442, 694, 722
AcsI	RAATTY	1 cut(s)	154
AfaI	GTAC	1 cut(s)	174
AfiI	CCNNNNNNNGG	1 cut(s)	293
AgsI	TTSAA	5 cut(s)	41, 205, 274, 322, 349
AjnI	CCWGG	1 cut(s)	486
AluBI	AGCT	6 cut(s)	76, 94, 134, 216, 553, 569
AluI	AGCT	6 cut(s)	76, 94, 134, 216, 553, 569
Alw21I	GWGCWC	1 cut(s)	571
AlwI	GGATC	3 cut(s)	442, 694, 722
AoxI	GGCC	1 cut(s)	508
ApeKI	GCWGC	3 cut(s)	8, 441, 533
ApoI	RAATTY	1 cut(s)	154
AsuC2I	CCSGG	1 cut(s)	105
AsuHPI	GGTGA	4 cut(s)	308, 632, 662, 677
BanII	GRGCYC	1 cut(s)	571
Bbv12I	GWGCWC	1 cut(s)	571
BbvI	GCAGC	2 cut(s)	453, 520
BccI	CCATC	2 cut(s)	295, 718
BceAI	ACGGC	2 cut(s)	277, 506
BciT130I	CCWGG	1 cut(s)	488
BcnI	CCSGG	1 cut(s)	105
BfaI	CTAG	1 cut(s)	23
BisI	GCNGC	6 cut(s)	9, 442, 445, 534, 637, 681
BlsI	GCNGC	6 cut(s)	10, 443, 446, 535, 638, 682
BmcAI	AGTACT	1 cut(s)	174
Bme1390I	CCNGG	2 cut(s)	105, 488
BmrFI	CCNGG	2 cut(s)	105, 488
BmsI	GCATC	4 cut(s)	273, 500, 536, 613
BpuEI	CTTGAG	1 cut(s)	610
BpuMI	CCSGG	1 cut(s)	105
BsaJI	CCNNGG	1 cut(s)	486
BsaWI	WCCGGW	1 cut(s)	475
Bsc4I	CCNNNNNNNGG	1 cut(s)	293
BseBI	CCWGG	1 cut(s)	488
BseDI	CCNNGG	1 cut(s)	486
BseGI	GGATG	2 cut(s)	551, 665
BseLI	CCNNNNNNNGG	1 cut(s)	293
BseMII	CTCAG	3 cut(s)	167, 180, 231
BseXI	GCAGC	2 cut(s)	453, 520
BseYI	CCCAGC	1 cut(s)	626
BsgI	GTGCAG	1 cut(s)	67
BshFI	GGCC	1 cut(s)	510
BsiHKAI	GWGCWC	1 cut(s)	571
BsiSI	CCGG	3 cut(s)	105, 476, 537
BslI	CCNNNNNNNGG	1 cut(s)	293
BsnI	GGCC	1 cut(s)	510
Bsp1286I	GDGCHC	1 cut(s)	571
Bsp143I	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
BspACI	CCGC	5 cut(s)	444, 526, 636, 680, 683
BspANI	GGCC	1 cut(s)	510
BspCNI	CTCAG	3 cut(s)	168, 179, 230
BspPI	GGATC	3 cut(s)	442, 694, 722
BssECI	CCNNGG	1 cut(s)	486
BssMI	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
Bst2UI	CCWGG	1 cut(s)	488
BstC8I	GCNNGC	2 cut(s)	551, 701
BstDEI	CTNAG	4 cut(s)	166, 176, 217, 452
BstF5I	GGATG	2 cut(s)	551, 665
BstKTI	GATC	6 cut(s)	85, 437, 466, 606, 689, 717
BstMBI	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
BstMWI	GCNNNNNNNGC	3 cut(s)	488, 700, 705
BstNI	CCWGG	1 cut(s)	488
BstSCI	CCNGG	2 cut(s)	103, 486
BstV1I	GCAGC	2 cut(s)	453, 520
BstX2I	RGATCY	2 cut(s)	434, 714
BstYI	RGATCY	2 cut(s)	434, 714
BsuRI	GGCC	1 cut(s)	510
BtsCI	GGATG	2 cut(s)	551, 665
BtsI	GCAGTG	1 cut(s)	405
BtsIMutI	CAGTG	1 cut(s)	405
Cac8I	GCNNGC	2 cut(s)	551, 701
CseI	GACGC	1 cut(s)	422
Csp6I	GTAC	1 cut(s)	173
CviAII	CATG	2 cut(s)	690, 704
CviQI	GTAC	1 cut(s)	173
DdeI	CTNAG	4 cut(s)	166, 176, 217, 452
DpnI	GATC	6 cut(s)	84, 436, 465, 605, 688, 716
DpnII	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
Ecl136II	GAGCTC	1 cut(s)	569
Eco24I	GRGCYC	1 cut(s)	571
Eco53kI	GAGCTC	1 cut(s)	569
EcoICRI	GAGCTC	1 cut(s)	569
EcoRII	CCWGG	1 cut(s)	486
EcoT38I	GRGCYC	1 cut(s)	571
FaeI	CATG	2 cut(s)	693, 707
FaiI	YATR	6 cut(s)	195, 254, 406, 677, 691, 705
FatI	CATG	2 cut(s)	689, 703
FauI	CCCGC	1 cut(s)	676
Fnu4HI	GCNGC	6 cut(s)	9, 442, 445, 534, 637, 681
FokI	GGATG	2 cut(s)	558, 672
FriOI	GRGCYC	1 cut(s)	571
Fsp4HI	GCNGC	6 cut(s)	9, 442, 445, 534, 637, 681
FspBI	CTAG	1 cut(s)	23
GluI	GCNGC	6 cut(s)	9, 442, 445, 534, 637, 681
GsaI	CCCAGC	1 cut(s)	630
HaeIII	GGCC	1 cut(s)	510
HapII	CCGG	3 cut(s)	105, 476, 537
HgaI	GACGC	1 cut(s)	422
Hin1II	CATG	2 cut(s)	693, 707
HincII	GTYRAC	1 cut(s)	163
HindII	GTYRAC	1 cut(s)	163
HindIII	AAGCTT	1 cut(s)	132
HinfI	GANTC	1 cut(s)	88
HpaII	CCGG	3 cut(s)	105, 476, 537
HphI	GGTGA	4 cut(s)	308, 632, 662, 677
Hpy166II	GTNNAC	1 cut(s)	163
Hpy188I	TCNGA	5 cut(s)	73, 87, 124, 169, 434
Hpy188III	TCNNGA	3 cut(s)	41, 230, 248
Hpy8I	GTNNAC	1 cut(s)	163
HpyCH4IV	ACGT	1 cut(s)	557
HpyCH4V	TGCA	4 cut(s)	11, 48, 549, 601
HpyF10VI	GCNNNNNNNGC	3 cut(s)	488, 700, 705
HpyF3I	CTNAG	4 cut(s)	166, 176, 217, 452
HpySE526I	ACGT	1 cut(s)	557
Hsp92II	CATG	2 cut(s)	693, 707
Kzo9I	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
LmnI	GCTCC	2 cut(s)	566, 574
LpnPI	CCDG	9 cut(s)	118, 423, 473, 489, 500, 550, 612, 632, 685
Lsp1109I	GCAGC	2 cut(s)	453, 520
LweI	GCATC	4 cut(s)	273, 500, 536, 613
MaeI	CTAG	1 cut(s)	23
MaeII	ACGT	1 cut(s)	557
MaeIII	GTNAC	1 cut(s)	207
MalI	GATC	6 cut(s)	84, 436, 465, 605, 688, 716
MboI	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
MfeI	CAATTG	1 cut(s)	291
MflI	RGATCY	2 cut(s)	434, 714
MhlI	GDGCHC	1 cut(s)	571
MluCI	AATT	5 cut(s)	147, 154, 278, 291, 299
MnlI	CCTC	6 cut(s)	171, 255, 294, 378, 521, 585
MseI	TTAA	6 cut(s)	182, 239, 258, 311, 338, 389
MslI	CAYNNNNRTG	1 cut(s)	123
MspA1I	CMGCKG	1 cut(s)	444
MspI	CCGG	3 cut(s)	105, 476, 537
MspR9I	CCNGG	2 cut(s)	105, 488
MunI	CAATTG	1 cut(s)	291
MvaI	CCWGG	1 cut(s)	488
MwoI	GCNNNNNNNGC	3 cut(s)	488, 700, 705
NciI	CCSGG	1 cut(s)	105
NdeII	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
NlaIII	CATG	2 cut(s)	693, 707
PcsI	WCGNNNNNNNCGW	1 cut(s)	519
PfeI	GAWTC	1 cut(s)	88
PflMI	CCANNNNNTGG	1 cut(s)	293
PkrI	GCNGC	6 cut(s)	10, 443, 446, 535, 638, 682
PsiI	TTATAA	1 cut(s)	195
Psp124BI	GAGCTC	1 cut(s)	571
Psp1406I	AACGTT	1 cut(s)	557
Psp6I	CCWGG	1 cut(s)	486
PspFI	CCCAGC	1 cut(s)	626
PspGI	CCWGG	1 cut(s)	486
PsuI	RGATCY	2 cut(s)	434, 714
RsaI	GTAC	1 cut(s)	174
RsaNI	GTAC	1 cut(s)	173
RseI	CAYNNNNRTG	1 cut(s)	123
SacI	GAGCTC	1 cut(s)	571
SaqAI	TTAA	6 cut(s)	182, 239, 258, 311, 338, 389
SatI	GCNGC	6 cut(s)	9, 442, 445, 534, 637, 681
Sau3AI	GATC	6 cut(s)	82, 434, 463, 603, 686, 714
ScaI	AGTACT	1 cut(s)	174
ScrFI	CCNGG	2 cut(s)	105, 488
SduI	GDGCHC	1 cut(s)	571
SfaNI	GCATC	4 cut(s)	273, 500, 536, 613
SmiMI	CAYNNNNRTG	1 cut(s)	123
SmlI	CTYRAG	1 cut(s)	589
SmoI	CTYRAG	1 cut(s)	589
Sse9I	AATT	5 cut(s)	147, 154, 278, 291, 299
SsiI	CCGC	5 cut(s)	444, 526, 636, 680, 683
SspMI	CTAG	1 cut(s)	23
SstI	GAGCTC	1 cut(s)	571
StyD4I	CCNGG	2 cut(s)	103, 486
TaiI	ACGT	1 cut(s)	560
TaqI	TCGA	2 cut(s)	231, 722
TasI	AATT	5 cut(s)	147, 154, 278, 291, 299
TatI	WGTACW	1 cut(s)	172
TauI	GCSGC	3 cut(s)	447, 639, 683
TfiI	GAWTC	1 cut(s)	88
Tru1I	TTAA	6 cut(s)	182, 239, 258, 311, 338, 389
Tru9I	TTAA	6 cut(s)	182, 239, 258, 311, 338, 389
TscAI	CASTG	1 cut(s)	405
TseI	GCWGC	3 cut(s)	8, 441, 533
TspDTI	ATGAA	3 cut(s)	344, 371, 664
TspRI	CASTG	1 cut(s)	405
Van91I	CCANNNNNTGG	1 cut(s)	293
XapI	RAATTY	1 cut(s)	154
XspI	CTAG	1 cut(s)	23
ZrmI	AGTACT	1 cut(s)	174

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.