MD00G1177700.v1.1

Protein of unknown function (DUF563)

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
41400127 .. 41400509
383 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1177700.v1.1.491

Sequence Viewer

Length: 252 bp
ATGATCGTGGTCCATGGAGCATCACTGACGCACTCTTTGTTCTTTCTACCAGGTTCTGTCTTGGTGGACAAGTATGGGAAGGAGAATTTCTTGCTAAAGGACCCATCTGCCCTTCTGAAAAAAGGTTGGCCATCTGAGTTTATGAAGATTTACATCAAGGAGCAAAATGTCAAACTAGATTTGGAAAGATTTAAGAGTTGTTTGAAGGAGGCTTATACAAAGACTAAGAGATTTGTGGACAAAAATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

84

Amino Acids

9.57

Weight (kDa)

9.55

Isoelectric Point (pI)

8.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 128
AcsI RAATTY 1 cut(s) 85
AgsI TTSAA 1 cut(s) 205
AjnI CCWGG 1 cut(s) 49
AlwNI CAGNNNCTG 1 cut(s) 56
AoxI GGCC 1 cut(s) 128
ApoI RAATTY 1 cut(s) 85
ArsI GACNNNNNNTTYG 2 cut(s) 19, 51
AspS9I GGNCC 2 cut(s) 10, 100
AvaII GGWCC 2 cut(s) 10, 100
BalI TGGCCA 1 cut(s) 130
BccI CCATC 2 cut(s) 112, 139
BciT130I CCWGG 1 cut(s) 51
BfaI CTAG 1 cut(s) 176
Bme1390I CCNGG 1 cut(s) 51
Bme18I GGWCC 2 cut(s) 10, 100
BmgT120I GGNCC 2 cut(s) 10, 100
BmiI GGNNCC 1 cut(s) 102
BmrFI CCNGG 1 cut(s) 51
BmsI GCATC 1 cut(s) 29
BsaBI GATNNNNATC 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 13
Bse8I GATNNNNATC 1 cut(s) 152
BseBI CCWGG 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 13
BseJI GATNNNNATC 1 cut(s) 152
BseMII CTCAG 1 cut(s) 126
BshFI GGCC 1 cut(s) 130
BsnI GGCC 1 cut(s) 130
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 13
BspANI GGCC 1 cut(s) 130
BspCNI CTCAG 1 cut(s) 127
BspLI GGNNCC 1 cut(s) 102
BssECI CCNNGG 1 cut(s) 13
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 13
Bst2UI CCWGG 1 cut(s) 51
BstDEI CTNAG 2 cut(s) 135, 225
BstDSI CCRYGG 1 cut(s) 13
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNI CCWGG 1 cut(s) 51
BstSCI CCNGG 1 cut(s) 49
BsuRI GGCC 1 cut(s) 130
BtgI CCRYGG 1 cut(s) 13
BtsIMutI CAGTG 1 cut(s) 23
CaiI CAGNNNCTG 1 cut(s) 56
Cfr13I GGNCC 2 cut(s) 10, 100
CseI GACGC 1 cut(s) 37
CsiI ACCWGGT 1 cut(s) 49
CviAII CATG 1 cut(s) 14
CviJI RGCY 2 cut(s) 130, 212
CviKI_1 RGCY 2 cut(s) 130, 212
DdeI CTNAG 2 cut(s) 135, 225
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EaeI YGGCCR 1 cut(s) 128
Eco130I CCWWGG 1 cut(s) 13
Eco47I GGWCC 2 cut(s) 10, 100
EcoO109I RGGNCCY 1 cut(s) 100
EcoRII CCWGG 1 cut(s) 49
EcoT14I CCWWGG 1 cut(s) 13
ErhI CCWWGG 1 cut(s) 13
FaeI CATG 1 cut(s) 17
FaiI YATR 4 cut(s) 15, 75, 143, 216
FatI CATG 1 cut(s) 13
FspBI CTAG 1 cut(s) 176
HaeIII GGCC 1 cut(s) 130
HgaI GACGC 1 cut(s) 37
Hin1II CATG 1 cut(s) 17
Hpy166II GTNNAC 2 cut(s) 67, 238
Hpy188I TCNGA 2 cut(s) 117, 136
Hpy8I GTNNAC 2 cut(s) 67, 238
HpyAV CCTTC 3 cut(s) 73, 122, 199
HpyF3I CTNAG 2 cut(s) 135, 225
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 2 cut(s) 17, 160
LpnPI CCDG 2 cut(s) 36, 63
LweI GCATC 1 cut(s) 29
MabI ACCWGGT 1 cut(s) 49
MaeI CTAG 1 cut(s) 176
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 157
MlsI TGGCCA 1 cut(s) 130
MluCI AATT 1 cut(s) 85
MluNI TGGCCA 1 cut(s) 130
MnlI CCTC 1 cut(s) 202
Mox20I TGGCCA 1 cut(s) 130
MscI TGGCCA 1 cut(s) 130
MseI TTAA 2 cut(s) 192, 250
Msp20I TGGCCA 1 cut(s) 130
MspR9I CCNGG 1 cut(s) 51
MvaI CCWGG 1 cut(s) 51
NcoI CCATGG 1 cut(s) 13
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 17
NlaIV GGNNCC 1 cut(s) 102
PpuMI RGGWCCY 1 cut(s) 100
Psp5II RGGWCCY 1 cut(s) 100
Psp6I CCWGG 1 cut(s) 49
PspGI CCWGG 1 cut(s) 49
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 2 cut(s) 10, 100
PspPPI RGGWCCY 1 cut(s) 100
PstNI CAGNNNCTG 1 cut(s) 56
SaqAI TTAA 2 cut(s) 192, 250
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 2 cut(s) 10, 100
ScrFI CCNGG 1 cut(s) 51
SetI ASST 2 cut(s) 55, 127
SexAI ACCWGGT 1 cut(s) 49
SfaNI GCATC 1 cut(s) 29
SgeI CNNG 9 cut(s) 19, 26, 62, 63, 73, 82, 103, 169, 188
SinI GGWCC 2 cut(s) 10, 100
Sse9I AATT 1 cut(s) 85
SspMI CTAG 1 cut(s) 176
StyD4I CCNGG 1 cut(s) 49
StyI CCWWGG 1 cut(s) 13
TasI AATT 1 cut(s) 85
Tru1I TTAA 2 cut(s) 192, 250
Tru9I TTAA 2 cut(s) 192, 250
TscAI CASTG 1 cut(s) 30
TspDTI ATGAA 1 cut(s) 158
TspRI CASTG 1 cut(s) 30
VpaK11BI GGWCC 2 cut(s) 10, 100
XapI RAATTY 1 cut(s) 85
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.