Rmu_sc0032189.1_g000001

Protein of unknown function (DUF563)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0032189.1
OG0001444
Physical Location & Seq
Reverse (-)
1582 .. 1887
306 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0032189.1_g000001.1.cds

Sequence Viewer

Length: 306 bp
atgcaaattgtgccgctagggactaattggttggcaaaagtgtgctatgaaaatccaggtagggcaatgaggctggagtacatggactataggattactgcggaggagagcaccttgttagaaacttacggaaaggataacattgtggttaagaatccgggagctaagattggtactaattggtccatggagattatgaagatttatctcaaggaacagaatatcaggttggatttggatagattttcttggtttttgaaggccgcttatgacaaggccaagaagtttatggacgaggaaggatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00514 map00514
Pfam Domains
Protein Families
DUF563

Protein Analysis

101

Amino Acids

11.85

Weight (kDa)

6.28

Isoelectric Point (pI)

19.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 14, 101, 264
AfaI GTAC 2 cut(s) 80, 175
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 1 cut(s) 55
AjuI GAANNNNNNNTTGG 2 cut(s) 212, 244
AluBI AGCT 1 cut(s) 164
AluI AGCT 1 cut(s) 164
Alw21I GWGCWC 1 cut(s) 113
AoxI GGCC 2 cut(s) 261, 276
AspS9I GGNCC 1 cut(s) 183
AsuC2I CCSGG 1 cut(s) 159
AvaII GGWCC 1 cut(s) 183
Bbv12I GWGCWC 1 cut(s) 113
BciT130I CCWGG 1 cut(s) 57
BcnI CCSGG 1 cut(s) 159
BfaI CTAG 1 cut(s) 17
BfmI CTRYAG 1 cut(s) 88
BisI GCNGC 2 cut(s) 14, 264
BlsI GCNGC 2 cut(s) 15, 265
Bme1390I CCNGG 2 cut(s) 57, 159
Bme18I GGWCC 1 cut(s) 183
BmgT120I GGNCC 1 cut(s) 183
BmrFI CCNGG 2 cut(s) 57, 159
BpmI CTGGAG 1 cut(s) 95
BpuEI CTTGAG 1 cut(s) 194
BpuMI CCSGG 1 cut(s) 159
BsaJI CCNNGG 1 cut(s) 186
Bse3DI GCAATG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 72
BseRI GAGGAG 1 cut(s) 119
BshFI GGCC 2 cut(s) 263, 278
BsiHKAI GWGCWC 1 cut(s) 113
BsiSI CCGG 1 cut(s) 158
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
BsnI GGCC 2 cut(s) 263, 278
Bsp1286I GDGCHC 1 cut(s) 113
Bsp19I CCATGG 1 cut(s) 186
BspACI CCGC 3 cut(s) 14, 101, 264
BspANI GGCC 2 cut(s) 263, 278
BsrDI GCAATG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 186
BssT1I CCWWGG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 57
BstAPI GCANNNNNTGC 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 165
BstDSI CCRYGG 1 cut(s) 186
BstMWI GCNNNNNNNGC 1 cut(s) 10
BstNI CCWGG 1 cut(s) 57
BstSCI CCNGG 2 cut(s) 55, 157
BstSFI CTRYAG 1 cut(s) 88
BsuRI GGCC 2 cut(s) 263, 278
BtgI CCRYGG 1 cut(s) 186
Cfr13I GGNCC 1 cut(s) 183
Csp6I GTAC 2 cut(s) 79, 174
CviAII CATG 2 cut(s) 82, 187
CviJI RGCY 4 cut(s) 73, 164, 263, 278
CviKI_1 RGCY 4 cut(s) 73, 164, 263, 278
CviQI GTAC 2 cut(s) 79, 174
DdeI CTNAG 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 186
Eco47I GGWCC 1 cut(s) 183
EcoRII CCWGG 1 cut(s) 55
EcoT14I CCWWGG 1 cut(s) 186
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 2 cut(s) 85, 190
FaiI YATR 7 cut(s) 48, 83, 90, 188, 197, 270, 290
FaqI GGGAC 1 cut(s) 34
FatI CATG 2 cut(s) 81, 186
Fnu4HI GCNGC 2 cut(s) 14, 264
Fsp4HI GCNGC 2 cut(s) 14, 264
FspBI CTAG 1 cut(s) 17
GluI GCNGC 2 cut(s) 14, 264
GsuI CTGGAG 1 cut(s) 95
HaeIII GGCC 2 cut(s) 263, 278
HapII CCGG 1 cut(s) 158
Hin1II CATG 2 cut(s) 85, 190
HinfI GANTC 1 cut(s) 154
HpaII CCGG 1 cut(s) 158
HpyAV CCTTC 2 cut(s) 253, 293
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 10
HpyF3I CTNAG 1 cut(s) 165
Hsp92II CATG 2 cut(s) 85, 190
LmnI GCTCC 1 cut(s) 161
LpnPI CCDG 5 cut(s) 42, 59, 69, 171, 211
MaeI CTAG 1 cut(s) 17
MboII GAAGA 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 113
MluCI AATT 3 cut(s) 6, 25, 178
MmeI TCCRAC 1 cut(s) 210
MnlI CCTC 3 cut(s) 63, 97, 289
MseI TTAA 1 cut(s) 150
MspI CCGG 1 cut(s) 158
MspR9I CCNGG 2 cut(s) 57, 159
MvaI CCWGG 1 cut(s) 57
MwoI GCNNNNNNNGC 1 cut(s) 10
NciI CCSGG 1 cut(s) 159
NcoI CCATGG 1 cut(s) 186
NlaIII CATG 2 cut(s) 85, 190
PfeI GAWTC 1 cut(s) 154
PfoI TCCNGGA 1 cut(s) 157
PkrI GCNGC 2 cut(s) 15, 265
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
PspPI GGNCC 1 cut(s) 183
RsaI GTAC 2 cut(s) 80, 175
RsaNI GTAC 2 cut(s) 79, 174
SaqAI TTAA 1 cut(s) 150
SatI GCNGC 2 cut(s) 14, 264
Sau96I GGNCC 1 cut(s) 183
ScrFI CCNGG 2 cut(s) 57, 159
SduI GDGCHC 1 cut(s) 113
SetI ASST 4 cut(s) 61, 116, 166, 230
SfcI CTRYAG 1 cut(s) 88
SinI GGWCC 1 cut(s) 183
SmlI CTYRAG 1 cut(s) 209
SmoI CTYRAG 1 cut(s) 209
Sse9I AATT 3 cut(s) 6, 25, 178
SsiI CCGC 3 cut(s) 14, 101, 264
SspMI CTAG 1 cut(s) 17
StyD4I CCNGG 2 cut(s) 55, 157
StyI CCWWGG 1 cut(s) 186
TasI AATT 3 cut(s) 6, 25, 178
TatI WGTACW 1 cut(s) 78
TauI GCSGC 2 cut(s) 16, 266
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TspDTI ATGAA 2 cut(s) 63, 212
TspGWI ACGGA 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 183
XcmI CCANNNNNNNNNTGG 1 cut(s) 286
XspI CTAG 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.