MD02G1025400.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
OG0002872
Physical Location & Seq
Forward (+)
1906874 .. 1908838
1965 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1025400.v1.1.491

Sequence Viewer

Length: 126 bp
ATGGCAAGTTGGCCGGCGTGTAAGTTTCCGGCGAGTCCGACGGCTTTCGAGGCGTTTTCCGGCCAAACCACGGCGAGTTATATGTCGTGTGAGGACTTAGAATCAAGGCACCTAATCCCGGCGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

42

Amino Acids

4.44

Weight (kDa)

4.83

Isoelectric Point (pI)

100.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 108
AcoI YGGCCR 2 cut(s) 11, 61
AfiI CCNNNNNNNGG 2 cut(s) 70, 118
AoxI GGCC 2 cut(s) 11, 61
AsuC2I CCSGG 1 cut(s) 119
BanI GGYRCC 1 cut(s) 108
BceAI ACGGC 2 cut(s) 57, 87
BcnI CCSGG 1 cut(s) 119
Bme1390I CCNGG 1 cut(s) 119
BmiI GGNNCC 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 119
BpuMI CCSGG 1 cut(s) 119
BsaJI CCNNGG 1 cut(s) 69
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 118
Bse118I RCCGGY 1 cut(s) 13
BseDI CCNNGG 1 cut(s) 69
BseLI CCNNNNNNNGG 2 cut(s) 70, 118
BshFI GGCC 2 cut(s) 13, 63
BshNI GGYRCC 1 cut(s) 108
BsiSI CCGG 4 cut(s) 14, 29, 60, 119
BslI CCNNNNNNNGG 2 cut(s) 70, 118
BsnI GGCC 2 cut(s) 13, 63
BspANI GGCC 2 cut(s) 13, 63
BspLI GGNNCC 1 cut(s) 110
BspT107I GGYRCC 1 cut(s) 108
BsrFI RCCGGY 1 cut(s) 13
BssAI RCCGGY 1 cut(s) 13
BssECI CCNNGG 1 cut(s) 69
BstC8I GCNNGC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 97
BstDSI CCRYGG 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstSCI CCNGG 1 cut(s) 117
BsuRI GGCC 2 cut(s) 13, 63
BtgI CCRYGG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 15
Cfr10I RCCGGY 1 cut(s) 13
CviJI RGCY 3 cut(s) 13, 44, 63
CviKI_1 RGCY 3 cut(s) 13, 44, 63
DdeI CTNAG 1 cut(s) 97
EaeI YGGCCR 2 cut(s) 11, 61
FaiI YATR 2 cut(s) 81, 83
HaeIII GGCC 2 cut(s) 13, 63
HapII CCGG 4 cut(s) 14, 29, 60, 119
HinfI GANTC 2 cut(s) 34, 101
HpaII CCGG 4 cut(s) 14, 29, 60, 119
Hpy188I TCNGA 1 cut(s) 39
Hpy99I CGWCG 1 cut(s) 43
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HpyF3I CTNAG 1 cut(s) 97
KroI GCCGGC 1 cut(s) 13
KroNI GCCGGC 1 cut(s) 15
LpnPI CCDG 3 cut(s) 27, 42, 73
MlyI GAGTC 1 cut(s) 43
MmeI TCCRAC 1 cut(s) 62
MnlI CCTC 2 cut(s) 43, 85
MroNI GCCGGC 1 cut(s) 13
MspI CCGG 4 cut(s) 14, 29, 60, 119
MspR9I CCNGG 1 cut(s) 119
MwoI GCNNNNNNNGC 1 cut(s) 50
NaeI GCCGGC 1 cut(s) 15
NciI CCSGG 1 cut(s) 119
NgoMIV GCCGGC 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 110
PdiI GCCGGC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 101
PleI GAGTC 1 cut(s) 42
PpsI GAGTC 1 cut(s) 42
PspN4I GGNNCC 1 cut(s) 110
SchI GAGTC 1 cut(s) 43
ScrFI CCNGG 1 cut(s) 119
SetI ASST 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 117
TaqI TCGA 1 cut(s) 48
TfiI GAWTC 1 cut(s) 101
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.