pycom17g06070

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0002872
Physical Location & Seq
Reverse (-)
4275321 .. 4276966
1646 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g06070.1

Sequence Viewer

Length: 303 bp
ATGCCCACACCTATAATTTCCCAGTTTTCCCGCGAGCACCGCCACTTTCGAGGAAATTTTCGGCCAAACCACGGCGAGTTGGCCGGCGTACAAGTTCCGGCGGACACCCGTGGCTTCCAGGCTGTTTTCCGGCCAACTCCGACCACGATGACGGGAAACAAGGGGGCGATTATCTGTGGCGTTTTCTTCTTCGCTAGATGGCGTGGCTTTTCGACGGCGAAGTACTCCAGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCCGCATCGGCATCTTCAAGTCTTCTCGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

101

Amino Acids

11.4

Weight (kDa)

11.39

Isoelectric Point (pI)

33.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 261
AccII CGCG 1 cut(s) 33
AciI CCGC 4 cut(s) 31, 40, 101, 272
AcoI YGGCCR 3 cut(s) 62, 81, 131
AcsI RAATTY 1 cut(s) 55
AcyI GRCGYC 1 cut(s) 258
AfaI GTAC 2 cut(s) 90, 224
AfiI CCNNNNNNNGG 1 cut(s) 71
AgsI TTSAA 1 cut(s) 287
AjnI CCWGG 2 cut(s) 117, 261
Alw21I GWGCWC 1 cut(s) 39
AoxI GGCC 3 cut(s) 62, 81, 131
ApoI RAATTY 1 cut(s) 55
BbsI GAAGAC 1 cut(s) 283
Bbv12I GWGCWC 1 cut(s) 39
BccI CCATC 1 cut(s) 192
BceAI ACGGC 2 cut(s) 88, 231
BciT130I CCWGG 2 cut(s) 119, 263
BfaI CTAG 1 cut(s) 195
BmcAI AGTACT 1 cut(s) 224
Bme1390I CCNGG 2 cut(s) 119, 263
BmrFI CCNGG 2 cut(s) 119, 263
BmrI ACTGGG 1 cut(s) 16
BmsI GCATC 2 cut(s) 283, 289
BmuI ACTGGG 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 283
BpmI CTGGAG 1 cut(s) 211
BsaHI GRCGYC 1 cut(s) 258
BsaJI CCNNGG 2 cut(s) 70, 109
Bsc4I CCNNNNNNNGG 1 cut(s) 71
Bse118I RCCGGY 1 cut(s) 83
Bse1I ACTGG 1 cut(s) 22
BseBI CCWGG 2 cut(s) 119, 263
BseDI CCNNGG 2 cut(s) 70, 109
BseLI CCNNNNNNNGG 1 cut(s) 71
BseNI ACTGG 1 cut(s) 22
Bsh1236I CGCG 1 cut(s) 33
BshFI GGCC 3 cut(s) 64, 83, 133
BsiHKAI GWGCWC 1 cut(s) 39
BsiSI CCGG 3 cut(s) 84, 98, 130
BslI CCNNNNNNNGG 1 cut(s) 71
BsnI GGCC 3 cut(s) 64, 83, 133
Bsp1286I GDGCHC 1 cut(s) 39
BspACI CCGC 4 cut(s) 31, 40, 101, 272
BspANI GGCC 3 cut(s) 64, 83, 133
BspFNI CGCG 1 cut(s) 33
BsrFI RCCGGY 1 cut(s) 83
BsrI ACTGG 1 cut(s) 22
BssAI RCCGGY 1 cut(s) 83
BssECI CCNNGG 2 cut(s) 70, 109
BssNI GRCGYC 1 cut(s) 258
Bst2UI CCWGG 2 cut(s) 119, 263
BstACI GRCGYC 1 cut(s) 258
BstC8I GCNNGC 2 cut(s) 35, 85
BstDEI CTNAG 1 cut(s) 233
BstDSI CCRYGG 2 cut(s) 70, 109
BstFNI CGCG 1 cut(s) 33
BstMWI GCNNNNNNNGC 1 cut(s) 39
BstNI CCWGG 2 cut(s) 119, 263
BstSCI CCNGG 2 cut(s) 117, 261
BstUI CGCG 1 cut(s) 33
BstV2I GAAGAC 1 cut(s) 283
BsuRI GGCC 3 cut(s) 64, 83, 133
BtgI CCRYGG 2 cut(s) 70, 109
Cac8I GCNNGC 2 cut(s) 35, 85
Cfr10I RCCGGY 1 cut(s) 83
Csp6I GTAC 2 cut(s) 89, 223
CviJI RGCY 6 cut(s) 64, 83, 114, 122, 133, 207
CviKI_1 RGCY 6 cut(s) 64, 83, 114, 122, 133, 207
CviQI GTAC 2 cut(s) 89, 223
DdeI CTNAG 1 cut(s) 233
EaeI YGGCCR 3 cut(s) 62, 81, 131
EciI GGCGGA 1 cut(s) 116
EcoRII CCWGG 2 cut(s) 117, 261
FaiI YATR 2 cut(s) 14, 247
FauI CCCGC 1 cut(s) 38
FspBI CTAG 1 cut(s) 195
GsuI CTGGAG 1 cut(s) 211
HaeIII GGCC 3 cut(s) 64, 83, 133
HapII CCGG 3 cut(s) 84, 98, 130
Hin1I GRCGYC 1 cut(s) 258
HinfI GANTC 1 cut(s) 237
HpaII CCGG 3 cut(s) 84, 98, 130
Hpy188I TCNGA 1 cut(s) 141
Hpy188III TCNNGA 2 cut(s) 228, 254
Hpy99I CGWCG 2 cut(s) 217, 260
HpyCH4IV ACGT 1 cut(s) 258
HpyF10VI GCNNNNNNNGC 1 cut(s) 39
HpyF3I CTNAG 1 cut(s) 233
HpySE526I ACGT 1 cut(s) 258
Hsp92I GRCGYC 1 cut(s) 258
KroI GCCGGC 1 cut(s) 83
KroNI GCCGGC 1 cut(s) 85
LpnPI CCDG 9 cut(s) 35, 97, 104, 111, 131, 143, 241, 248, 275
LweI GCATC 2 cut(s) 283, 289
MaeI CTAG 1 cut(s) 195
MaeII ACGT 1 cut(s) 258
MboII GAAGA 4 cut(s) 178, 181, 275, 283
MhlI GDGCHC 1 cut(s) 39
MluCI AATT 2 cut(s) 15, 55
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 2 cut(s) 44, 235
MroNI GCCGGC 1 cut(s) 83
MspI CCGG 3 cut(s) 84, 98, 130
MspR9I CCNGG 2 cut(s) 119, 263
MvaI CCWGG 2 cut(s) 119, 263
MvnI CGCG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 39
NaeI GCCGGC 1 cut(s) 85
NgoMIV GCCGGC 1 cut(s) 83
PdiI GCCGGC 1 cut(s) 85
PfeI GAWTC 1 cut(s) 237
Psp6I CCWGG 2 cut(s) 117, 261
PspGI CCWGG 2 cut(s) 117, 261
RsaI GTAC 2 cut(s) 90, 224
RsaNI GTAC 2 cut(s) 89, 223
ScaI AGTACT 1 cut(s) 224
ScrFI CCNGG 2 cut(s) 119, 263
SduI GDGCHC 1 cut(s) 39
SetI ASST 2 cut(s) 13, 261
SfaNI GCATC 2 cut(s) 283, 289
Sse9I AATT 2 cut(s) 15, 55
SsiI CCGC 4 cut(s) 31, 40, 101, 272
SspMI CTAG 1 cut(s) 195
StyD4I CCNGG 2 cut(s) 117, 261
TaiI ACGT 1 cut(s) 261
TaqI TCGA 3 cut(s) 49, 212, 240
TasI AATT 2 cut(s) 15, 55
TatI WGTACW 1 cut(s) 222
TfiI GAWTC 1 cut(s) 237
XapI RAATTY 1 cut(s) 55
XspI CTAG 1 cut(s) 195
ZraI GACGTC 1 cut(s) 259
ZrmI AGTACT 1 cut(s) 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.