pycom11g24370

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0002872
Physical Location & Seq
Forward (+)
27293719 .. 27295754
2036 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g24370.1

Sequence Viewer

Length: 432 bp
ATGAAGAAACCACCTCGGAGACATTTCCCCAGTTTTCCAGCGACCACCGCTCCTTTCGAGGCAATTTTCGTATGGAAGAAGTTATACTCATTTGAATCTTACCCAGTTTCCGGCGACCTCAGTGACTTTCGAGGCAATTTCCGGCCACACCACGGCGAGTTGGCCGGCTTGCGAGTTTCCGGCGACCTCAGTGACTTTCGAGGTGTTTTCCACCCAGACCCGTTTGACCCGGACCCGGGGCGATTATCTGTGGCGTTTCCTTCTTCGCTAGATGGCGTGGCTTTTCGACGACGAAGTACTGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCCGCATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCCTTTGTCTCATTCAATTTTATATTATTTTCTTCTAGTGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

144

Amino Acids

16.3

Weight (kDa)

9.73

Isoelectric Point (pI)

51.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 332
AccBSI CCGCTC 1 cut(s) 50
AciI CCGC 2 cut(s) 48, 343
AcoI YGGCCR 2 cut(s) 143, 162
AcyI GRCGYC 1 cut(s) 329
AfaI GTAC 1 cut(s) 298
AfiI CCNNNNNNNGG 4 cut(s) 110, 152, 235, 236
AgsI TTSAA 2 cut(s) 95, 397
AjnI CCWGG 1 cut(s) 332
Alw26I GTCTC 2 cut(s) 13, 394
Ama87I CYCGRG 1 cut(s) 235
AoxI GGCC 2 cut(s) 143, 162
AspS9I GGNCC 2 cut(s) 232, 375
AsuC2I CCSGG 3 cut(s) 230, 236, 237
AvaI CYCGRG 1 cut(s) 235
AvaII GGWCC 2 cut(s) 232, 375
BarI GAAGNNNNNNTAC 2 cut(s) 68, 100
BccI CCATC 1 cut(s) 266
BceAI ACGGC 1 cut(s) 169
BciT130I CCWGG 1 cut(s) 334
BcnI CCSGG 3 cut(s) 230, 236, 237
BcoDI GTCTC 2 cut(s) 13, 394
BfaI CTAG 3 cut(s) 269, 417, 425
BmcAI AGTACT 1 cut(s) 298
Bme1390I CCNGG 4 cut(s) 230, 236, 237, 334
Bme18I GGWCC 2 cut(s) 232, 375
BmeT110I CYCGRG 1 cut(s) 235
BmgT120I GGNCC 2 cut(s) 232, 375
BmiI GGNNCC 2 cut(s) 234, 377
BmrFI CCNGG 4 cut(s) 230, 236, 237, 334
BmrI ACTGGG 2 cut(s) 24, 98
BmsI GCATC 2 cut(s) 354, 360
BmuI ACTGGG 2 cut(s) 24, 98
BpuMI CCSGG 3 cut(s) 230, 236, 237
BsaHI GRCGYC 1 cut(s) 329
BsaJI CCNNGG 4 cut(s) 14, 151, 235, 236
BsaXI ACNNNNNCTCC 2 cut(s) 34, 64
Bsc4I CCNNNNNNNGG 4 cut(s) 110, 152, 235, 236
Bse118I RCCGGY 1 cut(s) 164
Bse1I ACTGG 2 cut(s) 30, 104
BseBI CCWGG 1 cut(s) 334
BseDI CCNNGG 4 cut(s) 14, 151, 235, 236
BseLI CCNNNNNNNGG 4 cut(s) 110, 152, 235, 236
BseMII CTCAG 2 cut(s) 133, 202
BseNI ACTGG 2 cut(s) 30, 104
BshFI GGCC 2 cut(s) 145, 164
BsiHKCI CYCGRG 1 cut(s) 235
BsiSI CCGG 6 cut(s) 111, 142, 165, 180, 230, 236
BslI CCNNNNNNNGG 4 cut(s) 110, 152, 235, 236
BsmAI GTCTC 2 cut(s) 13, 394
BsnI GGCC 2 cut(s) 145, 164
BsoBI CYCGRG 1 cut(s) 235
BspACI CCGC 2 cut(s) 48, 343
BspANI GGCC 2 cut(s) 145, 164
BspCNI CTCAG 2 cut(s) 132, 201
BspLI GGNNCC 2 cut(s) 234, 377
BsrBI CCGCTC 1 cut(s) 50
BsrFI RCCGGY 1 cut(s) 164
BsrI ACTGG 2 cut(s) 30, 104
BssAI RCCGGY 1 cut(s) 164
BssECI CCNNGG 4 cut(s) 14, 151, 235, 236
BssNI GRCGYC 1 cut(s) 329
Bst2UI CCWGG 1 cut(s) 334
BstACI GRCGYC 1 cut(s) 329
BstC8I GCNNGC 2 cut(s) 166, 170
BstDEI CTNAG 3 cut(s) 119, 188, 304
BstDSI CCRYGG 1 cut(s) 151
BstMAI GTCTC 2 cut(s) 13, 394
BstMWI GCNNNNNNNGC 1 cut(s) 47
BstNI CCWGG 1 cut(s) 334
BstSCI CCNGG 4 cut(s) 228, 234, 235, 332
BsuRI GGCC 2 cut(s) 145, 164
BtgI CCRYGG 1 cut(s) 151
BtsIMutI CAGTG 2 cut(s) 127, 196
Cac8I GCNNGC 2 cut(s) 166, 170
Cfr10I RCCGGY 1 cut(s) 164
Cfr13I GGNCC 2 cut(s) 232, 375
Cfr9I CCCGGG 1 cut(s) 235
Csp6I GTAC 1 cut(s) 297
CviJI RGCY 4 cut(s) 145, 164, 168, 281
CviKI_1 RGCY 4 cut(s) 145, 164, 168, 281
CviQI GTAC 1 cut(s) 297
DdeI CTNAG 3 cut(s) 119, 188, 304
EaeI YGGCCR 2 cut(s) 143, 162
Eco47I GGWCC 2 cut(s) 232, 375
Eco88I CYCGRG 1 cut(s) 235
EcoO109I RGGNCCY 1 cut(s) 375
EcoRII CCWGG 1 cut(s) 332
FaiI YATR 4 cut(s) 73, 85, 318, 404
FspBI CTAG 3 cut(s) 269, 417, 425
HaeIII GGCC 2 cut(s) 145, 164
HapII CCGG 6 cut(s) 111, 142, 165, 180, 230, 236
Hin1I GRCGYC 1 cut(s) 329
HinfI GANTC 3 cut(s) 95, 308, 359
HpaII CCGG 6 cut(s) 111, 142, 165, 180, 230, 236
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 2 cut(s) 325, 425
Hpy99I CGWCG 3 cut(s) 291, 294, 331
HpyAV CCTTC 1 cut(s) 270
HpyCH4IV ACGT 1 cut(s) 329
HpyF10VI GCNNNNNNNGC 1 cut(s) 47
HpyF3I CTNAG 3 cut(s) 119, 188, 304
HpySE526I ACGT 1 cut(s) 329
Hsp92I GRCGYC 1 cut(s) 329
KroI GCCGGC 1 cut(s) 164
KroNI GCCGGC 1 cut(s) 166
LmnI GCTCC 1 cut(s) 55
LweI GCATC 2 cut(s) 354, 360
MaeI CTAG 3 cut(s) 269, 417, 425
MaeII ACGT 1 cut(s) 329
MaeIII GTNAC 2 cut(s) 122, 191
MbiI CCGCTC 1 cut(s) 50
MboII GAAGA 5 cut(s) 16, 88, 255, 346, 405
MluCI AATT 3 cut(s) 63, 136, 397
MlyI GAGTC 1 cut(s) 368
MnlI CCTC 8 cut(s) 24, 52, 125, 128, 194, 197, 306, 373
MroNI GCCGGC 1 cut(s) 164
MspI CCGG 6 cut(s) 111, 142, 165, 180, 230, 236
MspR9I CCNGG 4 cut(s) 230, 236, 237, 334
MvaI CCWGG 1 cut(s) 334
MwoI GCNNNNNNNGC 1 cut(s) 47
NaeI GCCGGC 1 cut(s) 166
NciI CCSGG 3 cut(s) 230, 236, 237
NgoMIV GCCGGC 1 cut(s) 164
NlaIV GGNNCC 2 cut(s) 234, 377
NmuCI GTSAC 2 cut(s) 122, 191
PcsI WCGNNNNNNNCGW 1 cut(s) 354
PdiI GCCGGC 1 cut(s) 166
PfeI GAWTC 2 cut(s) 95, 308
PleI GAGTC 1 cut(s) 367
PpsI GAGTC 1 cut(s) 367
PpuMI RGGWCCY 1 cut(s) 375
Psp5II RGGWCCY 1 cut(s) 375
Psp6I CCWGG 1 cut(s) 332
PspGI CCWGG 1 cut(s) 332
PspN4I GGNNCC 2 cut(s) 234, 377
PspPI GGNCC 2 cut(s) 232, 375
PspPPI RGGWCCY 1 cut(s) 375
RsaI GTAC 1 cut(s) 298
RsaNI GTAC 1 cut(s) 297
Sau96I GGNCC 2 cut(s) 232, 375
ScaI AGTACT 1 cut(s) 298
SchI GAGTC 1 cut(s) 368
ScrFI CCNGG 4 cut(s) 230, 236, 237, 334
SetI ASST 5 cut(s) 16, 120, 189, 205, 332
SfaNI GCATC 2 cut(s) 354, 360
SinI GGWCC 2 cut(s) 232, 375
SmaI CCCGGG 1 cut(s) 237
Sse9I AATT 3 cut(s) 63, 136, 397
SsiI CCGC 2 cut(s) 48, 343
SspMI CTAG 3 cut(s) 269, 417, 425
StyD4I CCNGG 4 cut(s) 228, 234, 235, 332
TaiI ACGT 1 cut(s) 332
TaqI TCGA 6 cut(s) 57, 130, 199, 286, 311, 357
TasI AATT 3 cut(s) 63, 136, 397
TatI WGTACW 1 cut(s) 296
TfiI GAWTC 2 cut(s) 95, 308
TscAI CASTG 2 cut(s) 127, 196
TseFI GTSAC 2 cut(s) 122, 191
Tsp45I GTSAC 2 cut(s) 122, 191
TspDTI ATGAA 1 cut(s) 17
TspMI CCCGGG 1 cut(s) 235
TspRI CASTG 2 cut(s) 127, 196
VpaK11BI GGWCC 2 cut(s) 232, 375
XbaI TCTAGA 1 cut(s) 424
XmaI CCCGGG 1 cut(s) 235
XspI CTAG 3 cut(s) 269, 417, 425
ZraI GACGTC 1 cut(s) 330
ZrmI AGTACT 1 cut(s) 298
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.