pycom10g02960

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr10
OG0002872
Physical Location & Seq
Reverse (-)
3311269 .. 3312850
1582 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom10g02960.4

Sequence Viewer

Length: 294 bp
ATGACGAGTTGGCCGGCGTGCGAGTTTCCGGCGGACACCCGTGGCTTCCAGGCTGTTTTCCGGCCAACTCCAGCCACGTTGACGGAAACCAAGGGGGCGATTATCTGTGGCGTTTCCTTTTTCGCTAGATGGCGTGGCTTTTCGACGGCGAAGTACTCCGGCGACTTAGAATCGAGGCATACAATCCTGACGTCCAGGCACTTCCGCATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCCTTTGTTTCATTCAATTTTATATTATTTTCTTCTAGTGTTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.95

Weight (kDa)

9.49

Isoelectric Point (pI)

45.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 194
AciI CCGC 2 cut(s) 32, 205
AcoI YGGCCR 2 cut(s) 11, 62
AcyI GRCGYC 1 cut(s) 191
AfaI GTAC 1 cut(s) 155
AgsI TTSAA 1 cut(s) 259
AjnI CCWGG 2 cut(s) 48, 194
AoxI GGCC 2 cut(s) 11, 62
AspS9I GGNCC 1 cut(s) 237
AvaII GGWCC 1 cut(s) 237
BccI CCATC 1 cut(s) 123
BceAI ACGGC 1 cut(s) 162
BciT130I CCWGG 2 cut(s) 50, 196
BfaI CTAG 3 cut(s) 126, 279, 287
BmcAI AGTACT 1 cut(s) 155
Bme1390I CCNGG 2 cut(s) 50, 196
Bme18I GGWCC 1 cut(s) 237
BmgT120I GGNCC 1 cut(s) 237
BmiI GGNNCC 1 cut(s) 239
BmrFI CCNGG 2 cut(s) 50, 196
BmsI GCATC 2 cut(s) 216, 222
BpmI CTGGAG 1 cut(s) 54
BsaHI GRCGYC 1 cut(s) 191
BsaJI CCNNGG 2 cut(s) 40, 90
Bse118I RCCGGY 1 cut(s) 13
BseBI CCWGG 2 cut(s) 50, 196
BseDI CCNNGG 2 cut(s) 40, 90
BshFI GGCC 2 cut(s) 13, 64
BsiSI CCGG 4 cut(s) 14, 29, 61, 159
BsnI GGCC 2 cut(s) 13, 64
BspACI CCGC 2 cut(s) 32, 205
BspANI GGCC 2 cut(s) 13, 64
BspLI GGNNCC 1 cut(s) 239
BsrFI RCCGGY 1 cut(s) 13
BssAI RCCGGY 1 cut(s) 13
BssECI CCNNGG 2 cut(s) 40, 90
BssNI GRCGYC 1 cut(s) 191
BssT1I CCWWGG 1 cut(s) 90
Bst2UI CCWGG 2 cut(s) 50, 196
BstACI GRCGYC 1 cut(s) 191
BstC8I GCNNGC 2 cut(s) 15, 19
BstDEI CTNAG 1 cut(s) 166
BstDSI CCRYGG 1 cut(s) 40
BstNI CCWGG 2 cut(s) 50, 196
BstSCI CCNGG 2 cut(s) 48, 194
BsuRI GGCC 2 cut(s) 13, 64
BtgI CCRYGG 1 cut(s) 40
Cac8I GCNNGC 2 cut(s) 15, 19
Cfr10I RCCGGY 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 237
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 6 cut(s) 13, 45, 53, 64, 74, 138
CviKI_1 RGCY 6 cut(s) 13, 45, 53, 64, 74, 138
CviQI GTAC 1 cut(s) 154
DdeI CTNAG 1 cut(s) 166
EaeI YGGCCR 2 cut(s) 11, 62
EciI GGCGGA 1 cut(s) 47
Eco130I CCWWGG 1 cut(s) 90
Eco47I GGWCC 1 cut(s) 237
EcoO109I RGGNCCY 1 cut(s) 237
EcoRII CCWGG 2 cut(s) 48, 194
EcoT14I CCWWGG 1 cut(s) 90
ErhI CCWWGG 1 cut(s) 90
FaiI YATR 2 cut(s) 180, 266
FspBI CTAG 3 cut(s) 126, 279, 287
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 2 cut(s) 13, 64
HapII CCGG 4 cut(s) 14, 29, 61, 159
Hin1I GRCGYC 1 cut(s) 191
HincII GTYRAC 1 cut(s) 81
HindII GTYRAC 1 cut(s) 81
HinfI GANTC 2 cut(s) 170, 221
HpaII CCGG 4 cut(s) 14, 29, 61, 159
Hpy166II GTNNAC 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 187, 287
Hpy8I GTNNAC 1 cut(s) 81
Hpy99I CGWCG 1 cut(s) 148
HpyCH4IV ACGT 2 cut(s) 77, 191
HpyF3I CTNAG 1 cut(s) 166
HpySE526I ACGT 2 cut(s) 77, 191
Hsp92I GRCGYC 1 cut(s) 191
KroI GCCGGC 1 cut(s) 13
KroNI GCCGGC 1 cut(s) 15
LweI GCATC 2 cut(s) 216, 222
MaeI CTAG 3 cut(s) 126, 279, 287
MaeII ACGT 2 cut(s) 77, 191
MboII GAAGA 2 cut(s) 208, 267
MluCI AATT 1 cut(s) 259
MlyI GAGTC 1 cut(s) 230
MnlI CCTC 2 cut(s) 168, 235
MroNI GCCGGC 1 cut(s) 13
MspI CCGG 4 cut(s) 14, 29, 61, 159
MspR9I CCNGG 2 cut(s) 50, 196
MvaI CCWGG 2 cut(s) 50, 196
NaeI GCCGGC 1 cut(s) 15
NgoMIV GCCGGC 1 cut(s) 13
NlaIV GGNNCC 1 cut(s) 239
PcsI WCGNNNNNNNCGW 1 cut(s) 216
PdiI GCCGGC 1 cut(s) 15
PfeI GAWTC 1 cut(s) 170
PleI GAGTC 1 cut(s) 229
PpsI GAGTC 1 cut(s) 229
PpuMI RGGWCCY 1 cut(s) 237
Psp5II RGGWCCY 1 cut(s) 237
Psp6I CCWGG 2 cut(s) 48, 194
PspGI CCWGG 2 cut(s) 48, 194
PspN4I GGNNCC 1 cut(s) 239
PspPI GGNCC 1 cut(s) 237
PspPPI RGGWCCY 1 cut(s) 237
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
Sau96I GGNCC 1 cut(s) 237
ScaI AGTACT 1 cut(s) 155
SchI GAGTC 1 cut(s) 230
ScrFI CCNGG 2 cut(s) 50, 196
SetI ASST 2 cut(s) 80, 194
SfaNI GCATC 2 cut(s) 216, 222
SinI GGWCC 1 cut(s) 237
Sse9I AATT 1 cut(s) 259
SsiI CCGC 2 cut(s) 32, 205
SspMI CTAG 3 cut(s) 126, 279, 287
StyD4I CCNGG 2 cut(s) 48, 194
StyI CCWWGG 1 cut(s) 90
TaiI ACGT 2 cut(s) 80, 194
TaqI TCGA 3 cut(s) 143, 173, 219
TasI AATT 1 cut(s) 259
TatI WGTACW 1 cut(s) 153
TfiI GAWTC 1 cut(s) 170
TspDTI ATGAA 1 cut(s) 243
TspGWI ACGGA 1 cut(s) 98
VpaK11BI GGWCC 1 cut(s) 237
XbaI TCTAGA 1 cut(s) 286
XspI CTAG 3 cut(s) 126, 279, 287
ZraI GACGTC 1 cut(s) 192
ZrmI AGTACT 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.