pycom16g07130

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0002872
Physical Location & Seq
Reverse (-)
4644739 .. 4646207
1469 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g07130.1

Sequence Viewer

Length: 210 bp
ATGACGGGAACCAAGGGGGCGTTTAATTGTGGCGTTTCCGTCTTCGCTAGTGGCGTGGCTTTTCGACGGCGAAGTACTGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCCGCATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCTTTTATTTCATTCAATTTTATATTATTTTCTTTTAGTATTCTAGATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.81

Weight (kDa)

11.19

Isoelectric Point (pI)

48.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 110
AciI CCGC 1 cut(s) 121
AcyI GRCGYC 1 cut(s) 107
AfaI GTAC 1 cut(s) 76
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BbsI GAAGAC 1 cut(s) 34
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 112
BfaI CTAG 2 cut(s) 48, 203
BmcAI AGTACT 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 2 cut(s) 10, 155
BmrFI CCNGG 1 cut(s) 112
BmsI GCATC 2 cut(s) 132, 138
BpiI GAAGAC 1 cut(s) 34
BsaHI GRCGYC 1 cut(s) 107
BsaJI CCNNGG 1 cut(s) 12
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 12
BspACI CCGC 1 cut(s) 121
BspLI GGNNCC 2 cut(s) 10, 155
BssECI CCNNGG 1 cut(s) 12
BssNI GRCGYC 1 cut(s) 107
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 112
BstACI GRCGYC 1 cut(s) 107
BstDEI CTNAG 1 cut(s) 82
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BstV2I GAAGAC 1 cut(s) 34
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 75
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 153
EcoO109I RGGNCCY 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaiI YATR 2 cut(s) 96, 182
FspBI CTAG 2 cut(s) 48, 203
Hin1I GRCGYC 1 cut(s) 107
HinfI GANTC 2 cut(s) 86, 137
Hpy188III TCNNGA 2 cut(s) 103, 203
Hpy99I CGWCG 2 cut(s) 69, 109
HpyCH4IV ACGT 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 82
HpySE526I ACGT 1 cut(s) 107
Hsp92I GRCGYC 1 cut(s) 107
LpnPI CCDG 2 cut(s) 97, 124
LweI GCATC 2 cut(s) 132, 138
MaeI CTAG 2 cut(s) 48, 203
MaeII ACGT 1 cut(s) 107
MboII GAAGA 2 cut(s) 34, 124
MluCI AATT 2 cut(s) 25, 175
MlyI GAGTC 1 cut(s) 146
MnlI CCTC 2 cut(s) 84, 151
MseI TTAA 1 cut(s) 24
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
NlaIV GGNNCC 2 cut(s) 10, 155
PcsI WCGNNNNNNNCGW 2 cut(s) 51, 132
PfeI GAWTC 1 cut(s) 86
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PpuMI RGGWCCY 1 cut(s) 153
Psp5II RGGWCCY 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 2 cut(s) 10, 155
PspPI GGNCC 1 cut(s) 153
PspPPI RGGWCCY 1 cut(s) 153
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
SaqAI TTAA 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 153
ScaI AGTACT 1 cut(s) 76
SchI GAGTC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 112
SetI ASST 1 cut(s) 110
SfaNI GCATC 2 cut(s) 132, 138
SinI GGWCC 1 cut(s) 153
Sse9I AATT 2 cut(s) 25, 175
SsiI CCGC 1 cut(s) 121
SspMI CTAG 2 cut(s) 48, 203
StyD4I CCNGG 1 cut(s) 110
StyI CCWWGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 110
TaqI TCGA 3 cut(s) 64, 89, 135
TasI AATT 2 cut(s) 25, 175
TatI WGTACW 1 cut(s) 74
TfiI GAWTC 1 cut(s) 86
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 159
TspGWI ACGGA 1 cut(s) 28
VpaK11BI GGWCC 1 cut(s) 153
XbaI TCTAGA 1 cut(s) 202
XspI CTAG 2 cut(s) 48, 203
ZraI GACGTC 1 cut(s) 108
ZrmI AGTACT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.