pycom16g08890

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
OG0002872
Physical Location & Seq
Reverse (-)
5946007 .. 5947573
1567 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g08890.1

Sequence Viewer

Length: 198 bp
ATGACGGAAACCAAGGGGGCAATTATTTGTGGCGTTTCCGTCTTCGCTAGTGGCGTGGCTTTTCGACGGCGAAGTACTAACTTAGAATCGAGGCATACAATCCCAACGTCCAGGCACTTCCACATCGGCATCTTCGAGTCTTCTCGGTGTAGGACCCACTTCTTTGTTTCATTCAATTTTATATTATTTTTCTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.5

Weight (kDa)

11.25

Isoelectric Point (pI)

56.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 76
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 1 cut(s) 110
AspS9I GGNCC 1 cut(s) 153
AvaII GGWCC 1 cut(s) 153
BbsI GAAGAC 2 cut(s) 34, 132
BceAI ACGGC 1 cut(s) 83
BciT130I CCWGG 1 cut(s) 112
BfaI CTAG 2 cut(s) 48, 196
BmcAI AGTACT 1 cut(s) 76
Bme1390I CCNGG 1 cut(s) 112
Bme18I GGWCC 1 cut(s) 153
BmgT120I GGNCC 1 cut(s) 153
BmiI GGNNCC 1 cut(s) 155
BmrFI CCNGG 1 cut(s) 112
BmsI GCATC 1 cut(s) 138
BpiI GAAGAC 2 cut(s) 34, 132
BsaJI CCNNGG 1 cut(s) 12
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 12
BspLI GGNNCC 1 cut(s) 155
BssECI CCNNGG 1 cut(s) 12
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 82
BstNI CCWGG 1 cut(s) 112
BstSCI CCNGG 1 cut(s) 110
BstV2I GAAGAC 2 cut(s) 34, 132
Cfr13I GGNCC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 75
CviJI RGCY 1 cut(s) 59
CviKI_1 RGCY 1 cut(s) 59
CviQI GTAC 1 cut(s) 75
DdeI CTNAG 1 cut(s) 82
Eco130I CCWWGG 1 cut(s) 12
Eco47I GGWCC 1 cut(s) 153
EcoO109I RGGNCCY 1 cut(s) 153
EcoRII CCWGG 1 cut(s) 110
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaiI YATR 2 cut(s) 96, 182
FspBI CTAG 2 cut(s) 48, 196
HinfI GANTC 2 cut(s) 86, 137
Hpy99I CGWCG 1 cut(s) 69
HpyCH4IV ACGT 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 82
HpySE526I ACGT 1 cut(s) 107
LpnPI CCDG 2 cut(s) 97, 124
LweI GCATC 1 cut(s) 138
MaeI CTAG 2 cut(s) 48, 196
MaeII ACGT 1 cut(s) 107
MboII GAAGA 4 cut(s) 34, 124, 132, 184
MluCI AATT 2 cut(s) 21, 175
MlyI GAGTC 1 cut(s) 146
MnlI CCTC 1 cut(s) 84
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
NlaIV GGNNCC 1 cut(s) 155
PcsI WCGNNNNNNNCGW 2 cut(s) 51, 132
PfeI GAWTC 1 cut(s) 86
PleI GAGTC 1 cut(s) 145
PpsI GAGTC 1 cut(s) 145
PpuMI RGGWCCY 1 cut(s) 153
Psp5II RGGWCCY 1 cut(s) 153
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 155
PspPI GGNCC 1 cut(s) 153
PspPPI RGGWCCY 1 cut(s) 153
RsaI GTAC 1 cut(s) 76
RsaNI GTAC 1 cut(s) 75
Sau96I GGNCC 1 cut(s) 153
ScaI AGTACT 1 cut(s) 76
SchI GAGTC 1 cut(s) 146
ScrFI CCNGG 1 cut(s) 112
SetI ASST 1 cut(s) 110
SfaNI GCATC 1 cut(s) 138
SgeI CNNG 8 cut(s) 25, 60, 67, 102, 123, 124, 148, 156
SinI GGWCC 1 cut(s) 153
Sse9I AATT 2 cut(s) 21, 175
SspMI CTAG 2 cut(s) 48, 196
StyD4I CCNGG 1 cut(s) 110
StyI CCWWGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 110
TaqI TCGA 3 cut(s) 64, 89, 135
TasI AATT 2 cut(s) 21, 175
TatI WGTACW 1 cut(s) 74
TfiI GAWTC 1 cut(s) 86
TspDTI ATGAA 1 cut(s) 159
TspGWI ACGGA 2 cut(s) 20, 28
VpaK11BI GGWCC 1 cut(s) 153
XspI CTAG 2 cut(s) 48, 196
ZrmI AGTACT 1 cut(s) 76
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.