pycom07g16080

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr7
OG0002872
Physical Location & Seq
Forward (+)
18553512 .. 18555185
1674 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom07g16080.3

Sequence Viewer

Length: 378 bp
ATGCCCACACCTATAATTCTTTTCAAACCCCGTGGTTTTCCCAGTTTTCCGGCGAGCACCGCCCCTTTCGAGGAAATTTTCGGCCAAACCACGGCGAGTTGGCCGACGTACAAGTTTCCGGTGGACACCCGTGGCTTCCAGGCTGTTTTCCGGCCAACTCCGACCACGATGACGGGAACCAAGGGATGTTTATCTGTGGCATTTCCTTCTTCGCTAGATGGCGTGGCTTTTCGACGGCAAAGTACTGACTTAGAATCGAGGCATACAATCCCGACGTCCAGGCACTTCTGTATCGGCATCTTCGAGTCCTCTCGGTGTAGGACCCACTCCTTCGTTTCATTCAATTTTATATTATTTTCTTTTAGTGTTCTAGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.0

Weight (kDa)

9.41

Isoelectric Point (pI)

50.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 278
AciI CCGC 1 cut(s) 60
AcoI YGGCCR 3 cut(s) 82, 101, 152
AcsI RAATTY 1 cut(s) 75
AcyI GRCGYC 1 cut(s) 275
AfaI GTAC 2 cut(s) 110, 244
AfiI CCNNNNNNNGG 2 cut(s) 70, 91
AgsI TTSAA 2 cut(s) 25, 343
AjnI CCWGG 2 cut(s) 138, 278
Alw21I GWGCWC 1 cut(s) 59
AoxI GGCC 3 cut(s) 82, 101, 152
ApoI RAATTY 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 321
AvaII GGWCC 1 cut(s) 321
BaeI ACNNNNGTAYC 2 cut(s) 274, 307
Bbv12I GWGCWC 1 cut(s) 59
BccI CCATC 1 cut(s) 212
BceAI ACGGC 2 cut(s) 108, 251
BciT130I CCWGG 2 cut(s) 140, 280
BfaI CTAG 2 cut(s) 215, 371
BmcAI AGTACT 1 cut(s) 244
Bme1390I CCNGG 2 cut(s) 140, 280
Bme18I GGWCC 1 cut(s) 321
BmgT120I GGNCC 1 cut(s) 321
BmiI GGNNCC 2 cut(s) 178, 323
BmrFI CCNGG 2 cut(s) 140, 280
BmrI ACTGGG 1 cut(s) 36
BmsI GCATC 1 cut(s) 306
BmuI ACTGGG 1 cut(s) 36
BsaBI GATNNNNATC 1 cut(s) 190
BsaHI GRCGYC 1 cut(s) 275
BsaJI CCNNGG 4 cut(s) 31, 90, 130, 180
BsaWI WCCGGW 1 cut(s) 118
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 91
Bse1I ACTGG 1 cut(s) 42
Bse8I GATNNNNATC 1 cut(s) 190
BseBI CCWGG 2 cut(s) 140, 280
BseDI CCNNGG 4 cut(s) 31, 90, 130, 180
BseGI GGATG 1 cut(s) 191
BseJI GATNNNNATC 1 cut(s) 190
BseLI CCNNNNNNNGG 2 cut(s) 70, 91
BseNI ACTGG 1 cut(s) 42
BshFI GGCC 3 cut(s) 84, 103, 154
BsiHKAI GWGCWC 1 cut(s) 59
BsiSI CCGG 3 cut(s) 50, 119, 151
BslI CCNNNNNNNGG 2 cut(s) 70, 91
BsnI GGCC 3 cut(s) 84, 103, 154
Bsp1286I GDGCHC 1 cut(s) 59
BspACI CCGC 1 cut(s) 60
BspANI GGCC 3 cut(s) 84, 103, 154
BspLI GGNNCC 2 cut(s) 178, 323
BsrI ACTGG 1 cut(s) 42
BssECI CCNNGG 4 cut(s) 31, 90, 130, 180
BssNI GRCGYC 1 cut(s) 275
BssT1I CCWWGG 1 cut(s) 180
Bst2UI CCWGG 2 cut(s) 140, 280
BstACI GRCGYC 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 55
BstDEI CTNAG 1 cut(s) 250
BstDSI CCRYGG 3 cut(s) 31, 90, 130
BstF5I GGATG 1 cut(s) 191
BstMWI GCNNNNNNNGC 1 cut(s) 59
BstNI CCWGG 2 cut(s) 140, 280
BstSCI CCNGG 2 cut(s) 138, 278
BsuRI GGCC 3 cut(s) 84, 103, 154
BtgI CCRYGG 3 cut(s) 31, 90, 130
BtsCI GGATG 1 cut(s) 191
Cac8I GCNNGC 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 321
Csp6I GTAC 2 cut(s) 109, 243
CspCI CAANNNNNGTGG 2 cut(s) 13, 48
CviJI RGCY 6 cut(s) 84, 103, 135, 143, 154, 227
CviKI_1 RGCY 6 cut(s) 84, 103, 135, 143, 154, 227
CviQI GTAC 2 cut(s) 109, 243
DdeI CTNAG 1 cut(s) 250
EaeI YGGCCR 3 cut(s) 82, 101, 152
Eco130I CCWWGG 1 cut(s) 180
Eco47I GGWCC 1 cut(s) 321
EcoO109I RGGNCCY 1 cut(s) 321
EcoRII CCWGG 2 cut(s) 138, 278
EcoT14I CCWWGG 1 cut(s) 180
ErhI CCWWGG 1 cut(s) 180
FaiI YATR 3 cut(s) 14, 264, 350
FokI GGATG 1 cut(s) 198
FspBI CTAG 2 cut(s) 215, 371
HaeIII GGCC 3 cut(s) 84, 103, 154
HapII CCGG 3 cut(s) 50, 119, 151
Hin1I GRCGYC 1 cut(s) 275
HinfI GANTC 2 cut(s) 254, 305
HpaII CCGG 3 cut(s) 50, 119, 151
Hpy166II GTNNAC 1 cut(s) 124
Hpy188I TCNGA 1 cut(s) 162
Hpy188III TCNNGA 2 cut(s) 271, 371
Hpy8I GTNNAC 1 cut(s) 124
Hpy99I CGWCG 3 cut(s) 109, 237, 277
HpyAV CCTTC 2 cut(s) 216, 340
HpyCH4IV ACGT 2 cut(s) 107, 275
HpyF10VI GCNNNNNNNGC 1 cut(s) 59
HpyF3I CTNAG 1 cut(s) 250
HpySE526I ACGT 2 cut(s) 107, 275
Hsp92I GRCGYC 1 cut(s) 275
LpnPI CCDG 8 cut(s) 55, 63, 125, 132, 152, 164, 265, 292
LweI GCATC 1 cut(s) 306
MaeI CTAG 2 cut(s) 215, 371
MaeII ACGT 2 cut(s) 107, 275
MboII GAAGA 2 cut(s) 201, 292
MhlI GDGCHC 1 cut(s) 59
MluCI AATT 3 cut(s) 15, 75, 343
MlyI GAGTC 1 cut(s) 314
MmeI TCCRAC 1 cut(s) 185
MnlI CCTC 3 cut(s) 64, 252, 319
MseI TTAA 1 cut(s) 376
MspI CCGG 3 cut(s) 50, 119, 151
MspR9I CCNGG 2 cut(s) 140, 280
MvaI CCWGG 2 cut(s) 140, 280
MwoI GCNNNNNNNGC 1 cut(s) 59
NlaIV GGNNCC 2 cut(s) 178, 323
PcsI WCGNNNNNNNCGW 1 cut(s) 300
PfeI GAWTC 1 cut(s) 254
PleI GAGTC 1 cut(s) 313
PpsI GAGTC 1 cut(s) 313
PpuMI RGGWCCY 1 cut(s) 321
Psp5II RGGWCCY 1 cut(s) 321
Psp6I CCWGG 2 cut(s) 138, 278
PspGI CCWGG 2 cut(s) 138, 278
PspN4I GGNNCC 2 cut(s) 178, 323
PspPI GGNCC 1 cut(s) 321
PspPPI RGGWCCY 1 cut(s) 321
RsaI GTAC 2 cut(s) 110, 244
RsaNI GTAC 2 cut(s) 109, 243
SaqAI TTAA 1 cut(s) 376
Sau96I GGNCC 1 cut(s) 321
ScaI AGTACT 1 cut(s) 244
SchI GAGTC 1 cut(s) 314
ScrFI CCNGG 2 cut(s) 140, 280
SduI GDGCHC 1 cut(s) 59
SetI ASST 3 cut(s) 13, 110, 278
SfaNI GCATC 1 cut(s) 306
SinI GGWCC 1 cut(s) 321
Sse9I AATT 3 cut(s) 15, 75, 343
SsiI CCGC 1 cut(s) 60
SspMI CTAG 2 cut(s) 215, 371
StyD4I CCNGG 2 cut(s) 138, 278
StyI CCWWGG 1 cut(s) 180
TaiI ACGT 2 cut(s) 110, 278
TaqI TCGA 4 cut(s) 69, 232, 257, 303
TasI AATT 3 cut(s) 15, 75, 343
TatI WGTACW 1 cut(s) 242
TfiI GAWTC 1 cut(s) 254
Tru1I TTAA 1 cut(s) 376
Tru9I TTAA 1 cut(s) 376
TspDTI ATGAA 1 cut(s) 327
VpaK11BI GGWCC 1 cut(s) 321
XapI RAATTY 1 cut(s) 75
XbaI TCTAGA 1 cut(s) 370
XspI CTAG 2 cut(s) 215, 371
ZraI GACGTC 1 cut(s) 276
ZrmI AGTACT 1 cut(s) 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.